Animal

Trex1-knockout (KO) mice, originating from Cyagen Biosciences with a C57BL/6 J genetic background and featuring a targeted modification in the Trex1 gene (C57BL/6 JCya-Trex1em1/Cya), were utilized in this study. These Trex1-KO mice were procured from Cyagen Biosciences [14]. The animals were maintained under standardized conditions to ensure consistency and minimize environmental influences on the experimental outcomes. All procedures involving the animals were conducted in accordance with the guidelines for the ethical treatment of laboratory animals and were approved by the Jinling Hospital, Affiliated Hospital of Medical School, Nanjing University review board.

Animal model

Eight-week-old male mice were utilized for the induction of the experimental model, with a size of eight in each group. The DMM procedure was performed on mice under pentobarbital anesthesia at a dosage of 50 mg/kg. Following anesthesia, the mice were positioned on a sterile surgical platform where the left knee joint was prepared by shaving and standard aseptic technique. Under the guidance of a surgical microscope, the skin, subcutaneous tissues, and joint capsule of the left knee were sequentially incised. The tibial oblique ligament was severed between the anterior horn of the medial meniscus and the tibial spine, liberating the medial meniscus. The incision was meticulously closed in a layered fashion. Postoperative care included daily application of povidone-iodine to the incision site until full wound healing was achieved. 1, 2, and, 8 weeks post-model establishment, the mice were anesthetized with pentobarbital once more for the surgical extraction of the knee joint to conduct the necessary assessments.

Histological examination

Paraffin-embedded sections were deparaffinized in xylene for 30 min, after which specimens were subjected to a series of graded alcohol treatments followed by rinsing with PBS. Application of Hematoxylin staining for 15 s was succeeded by a water rinse to facilitate nuclear differentiation. Subsequently, Eosin Y staining was applied for 30 s to visualize the cytoplasm. The slides were then dehydrated, cleared in xylene, and prepared for microscopy by mounting with a coverslip. The stained slides were examined and imaged using a microscope to assess cellular structures and tissue morphology.

Safranin O/Fast Green staining is employed to assess the regenerative status of cartilage and bone tissues. The procedure involves staining tissue sections with Safranin O, followed by differentiation in a hydrochloric acid/ethanol solution and counterstaining with Fast Green. Subsequent rapid dehydration is achieved through a series of sequential ethanol baths. This staining technique enables the visualization of proteoglycan-rich cartilage, providing insights into the tissue’s regenerative capacity.

Toluidine Blue (TB) Staining is utilized for the observation of chondrogenesis. The staining process begins with the application of Toluidine blue to the tissue sections, which accentuates the cellular architecture. Following staining, the slides undergo a series of dehydration steps, are cleared with xylene, and subsequently mounted with a coverslip to prepare them for microscopic analysis, thereby facilitating the assessment of cartilage matrix and cell morphology.

Immunofluorescence assays

Immunofluorescence assays were conducted to evaluate cellular characteristics within articular cartilage tissue, including TUNEL staining for apoptosis, and the expression of CD86 and CD206 as markers for macrophage polarization. Chondrocyte proliferation was assessed using Edu staining, while oxidative stress was measured with DCFH-DA.

Immunohistochemistry assays

Immunofluorescence detection was conducted on osteoarticular cartilage tissue to evaluate the expression of SOX9, Aggrecan, and Col-II, which are pivotal for cartilage homeostasis.

Senescence-associated β-galactosidase (SA-β-gal) staining

SA-β-gal staining was performed to identify senescent chondrocytes within the cartilage tissue using a SA-β-gal staining kit (Beyotime, Jiangsu, China).

Flow cytometry

Chondrocyte apoptosis was assessed via flow cytometry using annexin V conjugated to a fluorophore (BD Biosciences). Cells were incubated with a 1:20 dilution of annexin V in binding buffer for 15 min at room temperature to detect phosphatidylserine exposure on apoptotic cells. After washing to remove unbound annexin V, cells were resuspended in binding buffer for analysis. Propidium iodide (PI) was used for differential labeling: early apoptotic cells were annexin V + PI−, and late apoptotic/necrotic cells were annexin V + PI+. Flow cytometric analysis provided a quantitative measure of apoptotic chondrocytes (FlowJo Software, USA).

Western blot (WB)

WB analysis assessed TREX1 and chondrogenic factors (SOX9, Aggrecan, MMP13, Col-II) in lysates. Cell pellets were resuspended in RIPA buffer with protease inhibitors. Primary antibodies to target proteins were added, incubated overnight at 4 °C, and immune complexes were captured with protein A/G-Plus Agarose beads. After washing, proteins were eluted and equal amounts separated on SDS-PAGE gels. Proteins were transferred to PVDF membranes, blocked with 5% FBS, and incubated with primary antibodies overnight. Following incubation with HRP-conjugated secondary antibodies, bands were visualized and quantified using chemiluminescence to determine protein expression levels.

Quantitative real-time RT-PCR (RT-qPCR)

RT-qPCR was utilized to assess gene expression levels. Total RNA was isolated from chondrocytes using the TRIzol reagent (Accurate Biology, Hunan, China) and subsequently reverse transcribed into cDNA with the Evo M-MLV Reverse Transcriptase Premix Kit. The RT-qPCR reactions were performed in the presence of SYBR Green (Accurate Biology, Hunan, China), and the data were normalized relative to the expression of the Gapdh. The primer sequence of c-Fos are shown as GGCCCACGAGACCTCTGAGACA (forward primer) and GCCTTGGCGCGTGTCCTAATCT (reverse primer).

Enzyme-linked immunosorbent assay (ELISA)

The supernatants from chondrocyte cultures, which were treated under various experimental conditions, were harvested for the quantification of the concentrations of CD86, CD206, tumor necrosis factor-alpha (TNF-α), interleukin-1beta (IL-1β), and interleukin-6 (IL-6) by ELISA kits procured from Servicebio (Wuhan, China).

Statistical analysis

Data normality and variance homogeneity were assessed using the Shapiro-Wilk test and the Brown-Forsythe test, respectively. For normally distributed data with equal variances, unpaired two-tailed t-tests were applied for two-group comparisons, while Welch’s correction was implemented for cases where equal variances were not assumed. Nonparametric Mann-Whitney U tests were utilized for data that failed normality tests or exhibited unequal variances. One-way ANOVA followed by Bonferroni post hoc analysis or non-parametric Kruskal-Wallis tests with Dunn’s multiple comparison procedure were employed for multiple group comparisons. Experiments with two factors were analyzed using two-way ANOVA with Bonferroni post hoc adjustments. In instances where variance homogeneity was not achieved, data transformation via logarithmic functions was applied prior to two-way ANOVA or multiple t-tests, followed by false discovery rate correction. For in vivo experiments involving repeated measures on the same subjects, such as sham and DMM surgery on individual mice, a repeated measures two-way ANOVA (RM-two way ANOVA) was employed. The statistical significance threshold was set at p < 0.05. All analyses were conducted using GraphPad Prism version 8.0 (San Diego, California, USA).