Generation of transgenic micePak1-eGFP mice

Pak1-eGFP transgenic line was obtained from the Mutant Mouse Resource & Research Centers [MMRRC # 010583-UCD, Tg(Pak1-EGFP)EJ8Gsat/Mmucd] which includes the enhanced green fluorescent protein (eGFP) coding sequence, followed by a polyadenylation signal, inserted into the mouse genomic bacterial artificial chromosome (BAC) RP23-126P9 at the start codon of Pak1 gene. This ensures that the eGFP reporter’s expression is controlled by the regulatory elements of Pak1 gene. The genotype can be identified using specific primers: Forward 5’-GGAGATGGATGAATGGGACTGAA-3’, and Reverse 5’-GGTCGGGGTAGCGGCTGAA-3’, producing a 550 bp fragment for the transgene. Pak1-eGFP mice were generated by the Mouse Biology Program (MBP) at UC Davis.

Pak1-null mice

Pak1-null mice (B6.129S2-Pak1tm1 Cher/Mmnc) were obtained from the Mutant Mouse Resource & Research Centers (MMRRC, #031838-UNC). In the Pak1-null mice, the Neo cassette was inserted into exon 4, generating a premature STOP codon in exon 5 (which encodes a p21-binding domain) and causing premature truncation of protein. Genotype primer sequences: Common-Forward: 5’-GCCCTTCACAGGAGCTTAATGA-3’; WT-reverse: 5’-GAAAGGACTGAATCTAATAGC-3’; Neo-reverse: 5’-CATTTGTCACGTCCTGCACGA-3’. Agarose gel electrophoresis bands: mutant 360 bp WT 240 bp.

Pak1-floxed mice

A Pak1-floxed transgenic line was generated through a targeting strategy that involved the insertion of two loxP sites flanking the 38-bp exon 5 of Pak1 gene (Supplementary Fig. 4 A). This manipulation was designed to allow the conditional deletion of exon 5. The WT PAK1 protein consists of 544 amino acids with an approximate molecular weight of 65 kDa. The engineered deletion of exon 5 introduces a premature stop codon (TGA) at the 18 th nucleotide of exon 6, resulting in a truncated PAK1 protein comprising 151 amino acids with an estimated weight of 18 kDa.

To facilitate the identification of the floxed alleles (Tm1c, fl/fl), a pair of primers, F1 (5’-GGACAACCTTGGGTATATTCCTCAG-3’) and R1 (5’-GAGAGAAGTTAAGTAATTTGCCCAGC-3’), was designed for PCR amplification of genomic DNA. PCR analysis of genomic DNA from transgenic mice yielded the expected band sizes: 445 bp for the WT alleles (+/+), 567 bp for the floxed alleles (fl/fl), and a combination of both for the heterozygous (fl/+) condition (Supplementary Fig. 4B). Additionally, primers F2 (5’-CGCTTGCTTCAAACATCAAATA-3’) and R2 (5’-GGTAGCATCGTCATCATCATCT-3’) were designed to detect the presence of Pak1 exon 5-deleted alleles (-/-) in cDNA synthesized from mRNA isolated from Cre-positive cells. The conditional deletion of exon 5 was confirmed by PCR amplification of cDNA prepared from brain oligodendroglial cells. These cells were isolated using magnetic-assisted cell sorting (MACS) with O4 antibody-conjugated magnetic microbeads from postnatal day 7 (P7) mice carrying Pak1fl/fl and Sox10-Cre:Pak1fl/fl. The PCR results displayed a band size of 240 bp for the floxed allele prior to Cre-mediated recombination and a band size of 202 bp post-exon 5 deletion, validating the expected genetic alteration in Cre-expressing cells (Supplementary Fig. 4 C). Tamoxifen was dissolved in a mixture of ethanol and sunflower seed oil (1:9, v/v) at the concentration of 30 mg/ml administered at a dose of 75 mg/kg body weight to Pdgfra-CreERT2 mice as indicated in each figure.

Pak inhibitor domain (PID) transgenic mice

PID, a peptide derived from the minimal autoinhibitory domain from Pak1 (minimally, corresponding to residues 83–149), was generated and characterized in our previous study [8]. In the PID transgenic mouse, the transcription of GST-PID is blocked by the presence of upstream “lox-stop-lox” (LSL) sequences. The LSL-PID mice were crossed with Pdgfra-CreERT2 mice. Upon exposure to Cre recombinase in the nucleus, the “stop” sequences between the loxP sites are excised, leading to expression of the GST-PID transgene. In the meanwhile, the IRES (internal ribosome entry site) allows eGFP expression in Cre positive PID-expressing cells. For Pdgfra-CreERT2:PID and littermate controls, tamoxifen was administered subcutaneously to neonatal pups on P1, P2, and P3 daily at a dose of 75 mg/kg body weight once a day and mice were killed at P7 for OPC proliferation assay.

OPC primary culture and proliferation assay

Primary mixed glial cells were isolated from the cerebral cortices of P0-P2 mice or rats, following our established protocols [32, 49], and cultured in T75 flasks coated with poly-D-lysine (PDL). The culture medium consisted of high-glucose DMEM, supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1% Penicillin/Streptomycin (P/S). The medium was refreshed every two days until the astrocyte layer reached confluency. To isolate microglia, the flasks were subjected to orbital shaking at 37 °C and 200 rpm for 1 h (Orbital shaker, Cat# C491, Hanchen), followed by a PBS wash. Subsequently, 20 mL of DMEM with 10% FBS was added to each flask. A further 6-h shake under the same conditions facilitated the collection of OPCs. The OPCs were then seeded on PDL-coated plates using serum-free complete growth medium (CGM). The CGM was formulated from 30% B104 neuroblastoma-conditioned medium and 70% N1 supplement (DMEM enriched with 5 mg/mL insulin, 50 mg/mL apo-transferrin, 100 µM putrescine, 30 nM sodium selenite, 20 nM progesterone, 5 ng/mL FGF (Peprotech), 4 ng/mL PDGF-AA (Peprotech), 50 µM Forskolin (Peprotech), and GlutaMAX (Thermo Fisher). For differentiation, OPCs were transitioned to differentiation medium (DM) composed of F12/high-glucose DMEM, supplemented with 12.5 mg/mL insulin, 100 µM Putrescine, 24 nM Sodium selenite, 10 nM Progesterone, 10 ng/mL Biotin, 50 mg/mL Transferrin, 30 ng/mL 3,3',5-Triiodo-L-thyronine, 40 ng/mL L-Thyroxine, GlutaMAX (Thermo Fisher), and P/S (Thermo Fisher) (all components from Sigma, unless noted).

Protein extraction and western blotting assay

Tissues or cells were lysed using N-PER Neuronal Protein Extraction Reagent (Thermo Fisher), supplemented with both a protease and phosphatase inhibitor cocktail (Thermo Fisher) and phenylmethylsulfonyl fluoride (PMSF; Cell Signaling Technology). The lysates were incubated on ice for 10 min, followed by centrifugation at 10,000 × g for 10 min at 4 °C. Protein concentrations in each sample were then determined using the BCA Protein Assay Kit (Thermo Fisher Scientific). Equal amounts of cell lysates (30 µg) from each experimental condition were separated on either Any kD Mini-PROTEAN TGX Precast Gels or 7.5% Mini-PROTEAN TGX Precast Gels (BIO-RAD), according to the protein's size. Proteins were subsequently transferred to 0.2 µm nitrocellulose membranes (BIO-RAD) using the Trans-Blot Turbo Transfer System (BIO-RAD). Membranes were blocked with 5% bovine serum albumin (BSA; Cell Signaling) for 1 h at room temperature, then incubated overnight at 4 °C with primary antibodies, followed by appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies. The targeted proteins were visualized using Western Lightning Plus ECL (Perkin Elmer), and protein levels were quantified with NIH ImageJ software. Primary antibodies used were: PAK1 (1:1000, #2602, Cell Signaling Technology), P-PAK1(Ser144) (1:1000, #2606, Cell Signaling Technology), PDGFRa (1:1000, #AF1062, NOVUS), P-PDGFRa(Y754) (1:1000, #ab5460, Abcam), P-PDGFRa(Y849) (1:1000, #ab79318, Abcam), MBP (1:1000, #NB600-717, Novus), ERK1/2 (1:1000, #9102, Cell Signaling Technology), P-ERK1/2(Thr202/Tyr204) (1:1000, #9101, Cell Signaling Technology), β-actin (1:1000, #4967, Cell Signaling Technology), and GAPDH (1:1000, #2118, Cell Signaling Technology). HRP-conjugated secondary antibodies (1:3000) are all from Thermo Fisher Scientific.

Co-immunoprecipitation (Co-IP) and LC–MS/MS analysis

Co-IP/LC–MS/MS assays were conducted utilizing the Pierce Classic Magnetic IP/Co-IP Kit (Thermo Fisher) in accordance with the manufacturer's protocols. Protein lysates (1 mg) underwent overnight incubation with 10 µg of either PAK1 primary antibody (#2602, Cell Signaling Technology) or Rabbit IgG isotype control (#2729, Cell Signaling Technology) at 4 °C. Subsequently, Pierce Protein A/G Magnetic Beads were washed three times using Pierce IP Lysis/Wash Buffer, followed by four times wash with 200 µL of 50 mM ammonium bicarbonate (AMBIC), shaking for 20 min at 4 °C. Then, 2.5 µg of Trypsin Gold (Mass Spectrometry Grade, V528 A, Promega) was introduced to the beads for overnight digestion at a shaking speed of 800 rpm at room temperature. Following digestion, peptide extracts were concentrated via vacuum centrifugation. An aliquot of the concentrated extract underwent fluorometric peptide quantification using the Thermo Scientific Pierce kit. The UC Davis Proteomics Core facilitated the LC–MS/MS analysis. Each analysis was performed with 1 µg of sample, as determined by the fluorometric peptide assay. These samples were analyzed on a Thermo Scientific Q Exactive Plus Orbitrap Mass Spectrometer, coupled with a Proxeon Easy-nLC II HPLC and Proxeon nanospray source. Proteome Discoverer (Thermo Scientific) was employed for tandem mass spectra extraction and charge state deconvolution. The X! Tandem software (The GPM, thegpm.org; version X! Tandem Alanine 2017.2.1.4) was used for analyzing all MS/MS samples, and Scaffold (version 4.8.4, Proteome Software Inc., Portland, OR) verified MS/MS-based peptide and protein identifications.

Co-Immunoprecipitation (Co-IP) and western blotting assay

Co-IP was carried out using the Pierce Crosslink Magnetic IP/Co-IP Kit (Thermo Fisher), adhering to the provided instructions. PAK1 primary antibody (#2602, Cell Signaling Technology) or Rabbit IgG isotype control (#2729, Cell Signaling Technology) (10 µg) were covalently cross-linked to 25 µL of Protein A/G Magnetic Beads (Thermo Fisher). Protein extraction was performed using Pierce IP Lysis/Wash Buffer (Thermo Fisher), supplemented with PMSF (Cell Signaling Technology) and a protease and phosphatase inhibitor cocktail (Thermo Fisher). A fraction of each sample was reserved as input. Equal amounts of protein extracts (1 mg) were incubated with the antibody- or IgG-cross-linked Protein A/G magnetic beads overnight at 4 °C. Post-incubation, the beads were washed to eliminate unbound material, and proteins were eluted using a low-pH elution buffer, which facilitates the dissociation of the antigen from the antibody-bead complex. The eluates were neutralized with Neutralization Buffer and prepared for SDS-PAGE and Western blotting by adding Lane Marker Sample Buffer containing β-mercaptoethanol.

RNA extraction and quantitative real-time PCR (qRT-PCR)

RNA was isolated using the RNeasy Lipid Tissue Mini Kit (QIAGEN), and genomic DNA contamination was eliminated with the RNase-Free DNase Set (QIAGEN). The concentration of RNA was determined using a Nanodrop 2000 Spectrophotometer (Thermo Fisher Scientific). Subsequently, cDNA was synthesized employing the QIAGEN Omniscript RT Kit (QIAGEN). The RT-qPCR analyses were conducted with the QuantiTect SYBR Green PCR Kit (QIAGEN) on an Agilent MP3005P thermocycler. mRNA expression levels of target genes in each sample were normalized to the internal control gene Hsp90. Fold changes in gene expression were calculated using the 2^(-ΔCt) method, where ΔCt represents the difference between the cycle threshold (Ct) of Hsp90 and the Ct of the target genes. The expression levels of genes in control samples were set to a baseline value of 1 for comparative purposes. Primer sequences are as follows.

qPCR gene name

Forward primer sequence

Reverse primer sequence

Sox10

ACACCTTGGGACACGGTTTTC

TAGGTCTTGTTCCTCGGCCAT

Pdgfrα

GAGAACAACGGAGGAGC

GCTGAGGACCAGAAAGACC

Mbp

GGCGGTGACAGACTCCAAG

GAAGCTCGTCGGACTCTGAG

Mog

AGCTGCTTCCTCTCCCTTCTC

ACTAAAGCCCGGATGGGATAC

Plp-E3b (exon 3b)

GTTCCAGAGGCCAACATCAAG

CTTGTCGGGATGTCCTAGCC

Hsp90

AAACAAGGAGATTTTCCTCCGC

CCGTCAGGCTCTCATATCGAAT

Ki67

AGCACAAAGAGACGGTCTAAGA

CTCTGCCTCGTGACTGTGTT

Opalin

ACACTGCCATCGAATACGACA

TGGATCAAGGTAAACAGCAAAGC

Pak1

CTGTGGCTGATTTCACTCACC

CCCACTGATTAAGTGCTGGTTG

Tissue preparation and immunohistochemistry (IHC)

Mice were anesthetized using a ketamine/xylazine mixture and subsequently perfused transcardially with ice-cold phosphate-buffered saline (PBS). Tissues were harvested and immediately placed on dry ice for subsequent protein or RNA extraction, or fixed in fresh 4% paraformaldehyde (PFA, Electron Microscopy Science) for histological analysis. Tissues were post-fixed in 4% PFA for 2 h at room temperature (RT), then washed with PBS three times for 15 min each. For cryopreservation, tissues were soaked in 30% sucrose (Fisher Chemical) in PBS overnight at 4 °C before being embedded in O.C.T. compound (VWR International). Serial coronal Sects. (12 µm thick) were prepared using a Leica Cryostat (CM 1900–3-1) and stored at −80 °C. For IHC, sections were air-dried at RT for 2 h and blocked with 10% donkey serum in 0.1% Triton X-100/PBS (v/v) for 1 h at RT. This was followed by overnight incubation with primary antibodies at 4 °C. After washing with PBS containing 0.1% Tween-20 (PBST, v/v), sections were incubated with fluorescence-conjugated secondary antibodies for 2 h at RT. DAPI was used for nuclear staining. Images were captured using a Nikon A1 confocal microscope. Sections with a 10 µm optical thickness were imaged via confocal z-stacking (step size: 1 µm) and compiled into a single, flattened image for quantification. Primary antibodies used were: PAK1 (1:100, #2602, Cell Signaling Technology), P-PAK1(Ser144) (1:100, #2606, Cell Signaling Technology), PDGFRα (1:100, #AF1062, NOVUS), CC1 (1:100, #OP80, MilliporeSigma), GST-π (1:100, #610718, BD Biosciences), MBP (1:200, #NB600-717, Novus), SMI312 (1:200, #837904, Biolegend), Sox10 (1:200, #ab155279, Abcam), Ki67 (1:100, #9129, Cell Signaling Technology), cleaved caspase3 (1:100, #9661, Cell Signaling Technology), PH3 (1:100, #9701, Cell Signaling Technology) and GFP antibody (1:200, #06–896, Millipore). Alexa Fluor®-conjugated secondary antibodies (1:500) are all from Jackson Immuno Research Laboratories.

Lysolecithin demyelination model and Neutral Red (NR) labeling

Lysolecithin (LPC, Sigma) was administered into the corpus callosum of mice using a stereotaxic apparatus. Prior to the procedure, mice were administered buprenorphine (0.1 mg/kg, subcutaneously) for pain relief and anesthetized with a mixture of ketamine (0.1 mg/g) and xylazine (0.01 mg/g). The injection site was precisely located at coordinates at + 1.000 mm anterior and + 1.000 mm lateral to the Bregma. The skull was carefully thinned with a drill, and a needle was inserted to a depth of 1.8 mm to target the rostral part of the corpus callosum. Using a microinjection pump, 2 μL of 1% LPC in 0.9% NaCl solution was injected over a period of 5 min. As a control, some mice received an injection of saline solution only. After injection, the needle was left in place for an additional 5 min to prevent backflow, then gradually withdrawn. P60 Pdgfrα-CreERT2:Pak1fl/fl or Pdgfrα-CreERT2:PID and Pdgfrα-CreERT2 control mice were administered with tamoxifen followed by stereotaxic injection of lysolecithin into the corpus callosum 2 weeks after. Post-surgery, mice were placed on a heated water pad for recovery until they were ready to be returned to their home cages. 5- or 14-days post-lesion (dpl), mice received an intraperitoneal (i.p.) injection of 500 μL of 1% Neutral Red (NR, Sigma-Aldrich) dissolved in PBS to label brain lesions. 2 h later, they were perfused intracardially with PBS, followed by the collection and fixation of brain tissue for histological analysis.

Immunocytochemistry (ICC)

Cells cultured on glass coverslips were fixed using 4% paraformaldehyde (PFA) for 30 min, then permeabilized with 0.1% Triton X-100 in PBS. Following permeabilization, cells were blocked with 10% donkey serum to prevent nonspecific antibody binding. After blocking, the cells were washed with PBS and incubated with primary antibodies overnight at 4 °C. Subsequently, cells were treated with fluorescence-conjugated secondary antibodies at a dilution of 1:200 for 2 h at room temperature. Nuclei staining was achieved using DAPI to facilitate visualization of cell nuclei. Fluorescent imaging was conducted with a Nikon A1 confocal microscope.

Plasmid transfection

Primary OPCs, at a density of 2 × 10^6, were seeded into poly-D-lysine (PDL)-coated wells of a 6-well plate one day before undergoing transfection. The transfection process utilized 6 μl of FuGENE (Roche Applied Science) and 2 μg of various plasmids, following the manufacturer’s guidelines. Specifically, cells were transfected with either 2 μg of an empty vector, 2 μg of a constitutively active PAK1 plasmid (pCMV6M-PAK1 T423E, Addgene plasmid # 12208 by Jonathan Chernoff), or 2 μg of a dominant-negative PAK1 plasmid (pCMV6M-PAK1 H83L H86L K299R, Addgene plasmid # 26592 by Jonathan Chernoff). This transfection was maintained for two days, after which the cells were processed for immunocytochemistry (ICC) and Western blotting assays.

Pak1 inhibitor treatment

For in vitro study, WT OPCs were seeded at a density of 10,000 cells per well on PDL-coated cover glasses within 24-well plates. One day post-seeding, the cells were treated with either the Pak inhibitor FRAX486 (15 nM), IPA3 (1 μM), NVS-PAK1-1 (100 nM) or a vehicle control, all diluted in CGM medium. This treatment was maintained for three days. On the fourth day, 10 µM EdU was added to the CGM medium, and the cells were incubated for an additional 2 h to facilitate EdU incorporation before the cells were fixed and permeabilized for subsequent analysis. The cells were cultured at 37 °C in a humidified atmosphere containing 5% CO2.

For in vivo study, WT mice received intraperitoneal injections of IPA3 at a dose of 5 mg/kg/day, or NVS-PAK1-1 at a dose of 0.5 mg/kg/day, or a vehicle control on postnatal days 2 (P2), 3 (P3), and 4 (P4). The mice were then prepared for analysis on P5. To label dividing cells, a 50 mg/kg dose of EdU was administered intraperitoneally 2 h prior to tissue collection for histological examination.

EdU-labeling study

A 5-ethynyl-uridine (EdU)-labeling experiment was conducted using the Click-iT EdU Imaging Kits by Invitrogen, adhering to the provided manufacturer’s guidelines. Mice underwent euthanasia 2 h post-intraperitoneal injection of EdU, dosed at 1 mg per mouse. Following euthanasia, brain specimens were harvested, fixed, and cryosectioned as described in the Tissue Collection and IHC protocol. The detection of EdU-labeled cells was achieved through the application of Click-iT reaction cocktails, also supplied by Invitrogen. Subsequently, the sections were incubated with primary and secondary PDGFRa antibodies and DAPI, before being mounted in the VectorShield mounting medium from Vector Laboratories. The mounted sections were then examined with an Olympus BX51 fluorescence microscope.

Magnetic activated cell sorting (MACS)

MACS was performed according to our published protocols [52, 54]. Whole mouse brains were dissected and cut into small pieces, then digested using the Neural Tissue Dissociation Kit (P) (Miltenyi Biotech), following the manufacturer's guidelines. The resulting cell suspension was passed through a cell strainer to achieve a single-cell suspension. For the magnetic labeling of microglia, cells were incubated with anti-CD11b microbeads for 15 min at 4 °C. Similarly, for the labeling of immature oligodendrocytes, the cells were treated with anti-O4 microbeads, and for astrocytes, with anti-ACSA2 microbeads, under the same conditions. Following each incubation with microbeads, magnetic separation was conducted using MS columns and the Octomacs manual separator. The isolated cells were flushed into tubes in 0.5% BSA in PBS (pH 7.2). After centrifugation, the cells were prepared for RNA extraction.

Quantification and statistical analysis

Data quantification was carried out by evaluators who were unaware of the genotypes and treatments. The results are presented as the mean ± SEM throughout this study. To visualize the data, scatter dot plots were employed, where each dot signifies an individual mouse or a separate experimental run. The Shapiro–Wilk test assessed the normality of the data distribution. For comparing two datasets, an unpaired two-tailed Student’s t-test was applied, with the degrees of freedom (df) indicated as t(df) in the figure legends. For analyses involving three or more groups, a one-way ANOVA with Tukey’s post-hoc test was utilized. The F ratio and degrees of freedom (numerator and denominator) were noted as F(DFn, DFd) in the figure legends, where DFn and DFd represent the degrees of freedom of the numerator and denominator, respectively. All graphical representations and statistical analyses were conducted using GraphPad Prism version 8.0. A P value of less than 0.05 was deemed statistically significant. The notation"ns"indicates a non-significant result, where the P value was greater than 0.05.