Animals and Animal Ethics Committee

Sprague-Dawley male rats (n = 72, 8-week old, weight 220–250 g) were supplied by Kaixue Biotechnology (Shanghai, China). The rats were housed in a specific pathogen-free room kept at a temperature of 22 °C with a 12-h day/night cycle. Approval from the Animal Ethics Committee of The First People’s Hospital of Yunnan province, Affiliated Hospital of Kunming University of Science and Technology was obtained before conducting the animal experiments.

Animal SCI Model and Transfection

Rats that had been deeply anaesthetized by inhalation of 2% isoflurane (Reward Life Technology, Shenzhen, China) were fixed on the operating table in the prone position. After the routine skin sterilization, the skin at the site of the T9/T10 vertebrae was cut. The exposed T9/T10 vertebrae were subjected to SCI construction by vertically dropping an Allen’s weight drop apparatus (weighing 10 g) from a height of 25 mm. The injured T9/T10 vertebrae area was flushed with 0.9% normal saline, and then the skin wound was sutured and routinely sterilized. The presence of the following symptoms in rats implied the successful establishment of the SCI model: oedema and haemorrhage of spinal cord, spastic tail wagging, retraction-like flutter and flaccid paralysis of bilateral hind limbs.

Adenovirus-mediated ALKBH5 overexpression vectors and ALKBH5 shRNA were commercially supplied by GeneChem (Shanghai, China). The two kinds of adenovirus (2 µL, 5 × 1013 TU/mL) were injected intrathecally into rats respectively 10 days prior to SCI surgery.

Animal Treatment and Grouping

The 72 rats were randomly divided into six groups: the Control group (n = 12), the SCI group (n = 12), the SCI + LD-LPS group (n = 12), the SCI + sh-ALKBH5 group (n = 12), the SCI + ALKBH5 group (n = 12), the SCI + LD-LPS + ALKBH5 group (n = 12). Rats in each group were treated as follows:

The Control group: rats were subjected to a similar SCI surgery process (but without the SCI construction).

The SCI group: SCI construction on rats was implemented.

The SCI + LD-LPS group: rats were pre-treated with LD-LPS (0.2 mg/kg) by intraperitoneal injection 72 h prior to the SCI construction.

The SCI + sh-ALKBH5 group: rats were injected intrathecally with Adenovirus-mediated ALKBH5 shRNA (10 days before SCI construction), and then experienced SCI construction.

The SCI + ALKBH5 group: after intrathecally injection of Adenovirus-mediated ALKBH5 overexpression vectors (10 days before SCI construction), rats were subjected to SCI construction.

The SCI + LD-LPS + ALKBH5 group: rats were sequentially subjected to the injection of Adenovirus-mediated ALKBH5 overexpression vectors (10 days before SCI construction), the pre-treatment of LD-LPS (72 h prior to the SCI construction), and then the construction of SCI.

After 3 days of SCI construction, rats were euthanized to gather the spinal cord tissues. The spinal cord tissues were preserved at -80 °C for subsequent detection.

Assessment of Motor Function

To assess nerve damage, the motor function of rats was evaluated using the Basso, Beattie and Bresnahan (BBB) locomotor rating scale after 2 days of SCI construction. The BBB score ranged from 0 to 21. A high BBB score instructed a favorable motor function and mild nerve damage. The BBB scoring criteria had been reported previously [16].

Hematoxylin and Eosin (H&E) Staining and Nissl Staining

The spinal cord tissues of rats were immersed in 4% paraformaldehyde (Huzhen Industrial, Shanghai, China) for 24 h for fixation. Before preparing tissue sections, the spinal cord tissues were embedded in paraffin. The tissue sections, which had been routinely dewaxed and rehydrated, were stained with hematoxylin solution (Huzhen Industrial, Shanghai, China) for 5 min and then with eosin solution (Huzhen Industrial, Shanghai, China) for 1 min. The residual staining solution was rinsed away by water. After routine dehydration and transparency, the dried sections were enclosed into neutral gum and placed under a microscope (Olympus Corporation, Tokyo, Japan) for observation.

For the examination of neuronal survival, the sections were stained with Nissl staining solution (Huzhen Industrial, Shanghai, China) for 40 min at a temperature of 60 °C, before being captured under the microscope.

Immunohistochemistry

The spinal cord tissues of rats, which had been routinely dewaxed and rehydrated, were immersed in 3% hydrogen peroxide for a 10-min treatment. After being blocked with 0.5% Triton X-100 (Huzhen Industrial, Shanghai, China) for 20 min at room temperature, the blockage of the sections was achieved by 5% bovine serum albumin (Yuanye Biotechnology, Shanghai, China) treatment for 30 min. The sections were probed with primary antibodies (for 12 h treatment at 4 °C), including rabbit anti-ALKBH5 (1:100, ab195377, Abcam, Cambridge, UK) and anti-Nrf2 (1:100, ab313825, Abcam, Cambridge, UK), Subsequently, the corresponding horseradish peroxidase labeled goat anti-rabbit secondary antibody (a dilution of 1:5000, ab205718, Abcam, Cambridge, UK) (for 2 h treatment at room temperature). After counterstaining by hematoxylin, the sections were routinely dehydrated and observed under a light microscope (Olympus Corporation, Tokyo, Japan) for the expression of ALKBH5 and Nrf2.

PC12 Cell Culture, Transfection and Treatment

Rat PC12 cells were commercially provided by Tongpai Biotechnology (Shanghai, China), and cultivated in Dulbecco’s modified Eagle Medium (DMEM) (Xinfan Biotechnology, Shanghai, China) suspended with 10% fetal bovine serum (FBS) (Xinfan Biotechnology, Shanghai, China) at 37 °C and 5% CO2.

ALKBH5 overexpression vectors, the corresponding negative control (NC) vectors, siRNAs targeting ALKBH5 and Nrf2, and NC siRNA were all purchased from GeneChem (Shanghai, China). PC12 cells, which had been plated into the 6-well plates with 1 × 105 cells in 1 mL serum-free DMEM were transfected with these vectors and siRNAs using Lipofectamine 3000 reagent (Thermo Fisher Scientific, San Jose, CA USA). In the transfection process, PC12 cells were divided into different groups: the ALKBH5 group, the NC group, the siALKBH5 group, the Nrf2 group, and the siNC group. After 8 h of transfection, the PC12 cells were cultured in DMEM supplemented with 10% FBS.

LD-LPS at different final concentrations (0.1, 0.2, 0.3 and 0.4 µg/mL) were adopted to treat PC12 cells for 24 h in order to determine the optimal dose. In the subsequent experiments, the optimal dose of LD-LPS (0.2 µg/mL) was chosen to pre-treat PC12 cells for 24 h prior to oxygen and glucose deprivation/reoxygenation (OGD/R). In the OGD/R treatment, PC12 cells were first subjected to OGD treatment for 4 h, followed by reoxygenation treatment for 24 h. PC12 cells that did not receive any treatment were designated as the control group.

Cell Counting kit-8 (CCK-8) Assay

PC12 cells were plated into the 96-well plates with 1 × 104 cells/100 µL medium per well and then treated under the respective conditions at 37 °C and 5% CO2. After incubating for 2 h at 37 °C with 10 µL CCK-8 solution (Huzhen Industrial, Shanghai, China), the PC12 cells were placed under a microplate reader (Biotek, Winooski, VT, USA) to read the OD values.

Enzyme-Linked Immunosorbent Assay (ELISA)

Spinal cord tissues and PC12 cells were collected and then homogenized on ice for 10 min using a homogenizer. The supernatant was obtained by centrifuging the homogenate for 5 min at 4 °C and 10,000 rpm. Malondialdehyde (MDA) level and superoxidedismutase (SOD) activity in the supernatant were monitored using MDA assay kit (Xinfan Biotechnology, Shanghai, China) and SOD activity assay kit (Xinfan Biotechnology, Shanghai, China). The detection process was executed following the commercial kit instructions.

Cell Morphology Observation

After receiving the appropriate treatment, PC12 cells from various treatment groups were placed under an electron microscope (Olympus Corporation, Tokyo, Japan) to observe any morphological changes.

Flow Cytometry

Apoptosis of PC12 cells from different treatment groups was assayed by flow cytometry. PC12 cells were treated with fluorescein isothiocyanate-labeled Annexin V (Biolab Technology, Beijing, China) for 15 min in a dark environment, followed by staining with propidium iodide (Biolab Technology, Beijing, China) for 5 min.The apoptotic cells were evaluated by a FACSort™ flow cytometer (Becton Dickinson, San Jose, CA, USA), and qualified with the CellQuest™ software system (Becton Dickinson, San Jose, CA, USA).

Methylated RNA Immunoprecipitation (Me-RIP) Assay

The level of Nrf2 m6A modification was assessed using Me-RIP assay. Total RNA that had been extracted from spinal cord tissues and PC12 cells using Trizol reagent (Tongwei Biological, Shanghai, China) were isolated with the PolyATtract® mRNA Isolation System (Kanglang Biotechnology, Shanghai, China). Antibodies against m6A (1:100, ab208577, Abcam, Cambridge, UK) and IgG (1:100, ab182931, Abcam, Cambridge, UK) were separately added into immunoprecipitation buffer containing protein A/G magnetic beads (AmyJet Scientific Technology, Wuhan, China) a 1-hour incubation. Subsequently, the immunoprecipitation buffer containing protease and RNase inhibitors was incubated with the purified mRNA and the magnetic beads-antibody complex for 12 h at a temperature of 4 °C. Elution buffer (Guyan Industrial, Shanghai, China) was adopted to elute RNA, and the phenol-chloroform extraction method was employed to purify RNA. The enrichment of Nrf2 m6A was qualified by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR).

Dot-Blot Experiment

The Dot-Blot experiment was conducted to measure the Nrf2 m6A level. PC12 cells were collected for total RNA extraction using Trizol reagent. After being purified by the PolyATtract® mRNA Isolation System, the isolated RNA was subjected to ultraviolet irradiation for 7 min to denature mRNA denaturation. Subsequently, the RNA was spotted onto Amersham Hybond-N membranes (Limin Industrial, Shanghai, China). The ultraviolet cross-linking was followed by sequentially performing the phosphate buffered saline-Tween 20 washing was sequentially performed. RNA was blocked in 5% skimmed milk (Huzhen Industrial, Shanghai, China) before being probed with anti-m6A antibody (1:1000, ab208577, Abcam, Cambridge, UK) for 12 h at a temperature of 4 °C. After being treated with a horseradish peroxidase-conjugated secondary antibody (1:3000, ab205718, Abcam, Cambridge, UK), Chemilum HRP Substrate (Beinuo Biotechnology, Shanghai, China) was responsible for visualizing the dots.

RNA Pull-Down Assay

The binding between ALKBH5 and Nrf2 was verified by RNA pull-down assay. Pierce Magnetic RNA-Protein Pull-down Kit, commercially supplied by Thermo Fisher Scientific (San Jose, CA USA), was adopted for RNA pull-down assay. The experimental procedure was strictly executed in accordance with the manufacturer’s instructions. The prepared PC12 cell lysate was treated with biotinylated RNA and streptavidin-coated magnetic beads for a 2-h pull-down at 4 °C with rotation.Proteins that had been bound were retrieved by boiling in loading buffer. The Nrf2 protein that was bound was identified by Western blot analysis.

Actinomycin D Experiment

After 24 h of transfection, actinomycin D (2 µg/mL) was added into the culture medium to treat cells for a specific time (0, 60, 120, 180 and 240 min, respectively). At each time point, PC12 cells were gathered for total RNA isolation by Trizol reagent. The level of Nrf2 mRNA was examined by qRT-PCR.

qRT-PCR

Spinal cord tissues and PC12 cells were collected and then added to Trizol reagent for the extraction of total RNA. To synthesize the cDNA template, a reverse transcription reaction was performed using a PrimeScript RT Kit (Takara, Shiga, Japan) under the reaction conditions of 15 min at 37 °C and 5 s at 85 °C. The qRT-PCR was executed using the ABI Prism 7500 Real Time PCR system along with SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA). The conditions included 5 min at 94 °C, followed by 39 cycles of 30 s at 95 °C and 30 s at 58 °C, and finally 5 min at 72 °C. The primers used were as follows: ALKBH5 sense primer, GCAAGTTCCAGTTCAAGCCC, and antisense primer, CATCAGCAGCATACCCACTGA.Nrf2: sense - CACATCCAGACAGACACCAGT, antisense - CTACAAATGGGAATGTCTCTGC. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH): sense - GGAGAGTGTTTCCTCGTCCC, antisense - ATGAAGGGGTCGTTGATGGC. GAPDH played a role as a control gene. The relative mRNA expression for ALKBH5 and Nrf2 was determined by the 2−ΔΔCT method.

Western Blot

Spinal cord tissues were minced and then homogenized in radio-immuno precipitation assay (RIPA) lysis buffer (Huzhen Industrial, Shanghai, China) for total protein extraction. PC12 cells treated under the relevant conditions were gathered and dispersed into RIPA lysis buffer for the acquisition of total proteins. BCA Protein Quantification Kit (Huzhen Industrial, Shanghai, China) was recruited for the content determination of the total proteins. The separation of total proteins was achieved by treatment with 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Afterwards, the proteins were loaded onto polyvinylidene fluoride membranes through electrotransfer method, followed by blockage in 5% skimmed milk for 1 h at room temperature. Overnight incubation of proteins was executed at 4 °C by using primary antibodies (a dilution of 1:1000). Rabbit anti-ALKBH5 (ab195377), anti-Nrf2 (ab313825), anti-Bax (ab32503), and anti-GAPDH (ab181602) primary antibodies were all commercially provided by Abcam (Cambridge, UK). Rabbit anti-cleaved caspase-3 (C-caspase-3) (9661) was provided by Cell Signaling Technology (Beverly, MA, USA). Horseradish peroxidase labeled goat anti-rabbit secondary antibody (a dilution of 1:5000, ab205718), purchased from Abcam (Cambridge, UK), was adopted for 2 h treatment of the proteins. The visualization of the reactive blots was finished by the enhanced chemiluminescent reagent (Huzhen Industrial, Shanghai, China) treatment. The reactive blots were qualified by the Image J software (NIH, Bethesda, MD, USA) by taking GAPDH as a reference.

Dihydroethidium (DHE) Staining

The content of reactive oxygen species (ROS) in PC12 cells and spinal cord tissues of rats was examined by DHE staining. PC12 cells were plated into 6-well plates (1 × 105 cells/mL medium per well). Before cell inoculation, a coverslip was placed on the bottom of each well. After cultured under the relevant conditions, PC12 cells were stained by DHE staining solution (Biolab Technology, Beijing, China) for 15 min at 37 °C, and then by Hoechst staining solution (Beyotime, Shanghai, China) for 5 min in the dark. Spinal cord tissues of rats were prepared as frozen tissue  sections (4 μm). Under a dark condition, the sections were incubated with DHE staining solution for 30 min at 37 °C. Hoechst staining solution was dropped onto the sections to stain the nuclei of cells for 5 min. Finally, PC12 cells on the coverslip and the spinal cord tissue sections were dried, sealed in neutral resin, and observed under a fluorescence microscopy (Olympus Corporation, Tokyo, Japan).

The Terminal Transferase Uridyl Nick End Labeling (TUNEL) Assay

A coverslip was placed on the bottom of the 6-well plates, and then 1 × 105 PC12 cells in 1 mL medium were grown into each well. Following the relevant treatment, PC12 cell apoptosis was scrutinized using a commercial TUNEL assay kit (Zeye Biotechnology, Shanghai, China). Regarding spinal cord tissues, the prepared tissue sections underwent 0.1% Triton X-100 (Zeye Biotechnology, Shanghai, China) treatment for 10 min at room temperature, followed by TUNEL staining with the commercial kit. Staining of nuclei was carried out by 4’-6-diamidino-2-phenylindole (DAPI) solution (Beyotime, Shanghai, China) treatment. The apoptotic cell observation was performed under the fluorescence microscope (Olympus Corporation, Tokyo, Japan).

Statistical Analysis

All experiments in this study were conducted independently at least three times. The data was presented as mean ± standard deviation and analyzed using SPSS 23.0 software (IBM, Armonk, NY, USA). Statistical graphs with error bars were created based on mean ± standard deviation. The normally distributed data that had been verified by the Shapiro-Wilk test were statistically analyzed by one-way analysis of variance along with post-hoc Tukey’s test. Graphs were drawn by GraphPad Prism 9 software (GraphPad Software, San Diego, CA, USA). P < 0.05 was defined as a statistically significant difference.