SKOV3, a human epithelial ovarian cancer cell line, was purchased from the Shanghai Cell Institute of the Chinese Academy of Sciences. BALB/c nude mice, which were female, three to four weeks old and fifteen to twenty grams in weight, were selected and bought from Yangzhou University, China.
2.2 ReagentsThese reagents were purchased from the next companies. The quantitative PCR kits, Roche Company. Molecular cloning related reagents, Promega Company, USA. RNA extraction kit and liposome 2000, Invitrogen Company. G418, Sigma Company. Transwell Chambers, Corning Company, USA. Matri Gel, BD Company. RT, PCR kits, human zinc finger E-Box binding homeobox 1 antibody, Shanghai Bioengineering Co., Ltd. Immunohistochemistry detection kits, Shanghai Bioengineering Co., Ltd.
2.3 Reverse transcription PCR and RT-qPCRThe checked RNA was drawn from SKOV3 or transfected SKOV3 cells and transplanted tumor tissues in tumor-bearing mice. Specific and random primers for reverse transcription were used to amplify the lncRNA HOTAIR and the mRNAs of TGF-β1, ZEB1 and E-cadherin for RT-PCR and quantitative PCR. Meanwhile, human β-actin was used as an internal reference for testing. The lncRNA HOTAIR(Gene ID: 100124700)primers, were as followed: up 5ʹ—GGTAGAAAAAGCAA CCACGAAGC—3ʹ, down5ʹ—TTGGGGAAGCATTTTCTGAC—3ʹ, product 744 bp. Long-chain noncoding RNA HOTAIR was checked by reverse transcription PCR and quantitative PCR. The primers for human E-cadherin, were up 5ʹ—TACACTGCCCAGGAGCCAGA—3ʹ, down 5ʹ—TGGCACCAGTGTCCGGATTA—3ʹ, and the obtained product 103 bp. The primers of human ZEB1, up 5ʹ—TAAAGTGGCGGTAGATGGTA—3ʹ, down 5ʹ—CTGTTTGTAGCGACTGGATT—3ʹ, product 258 bp. The human TGF-β1 primers, were up 5ʹ—AGTGGACATCAACAACGGGTTCAC—3ʹ, down 5ʹ—ATGAGAAGCAGGAAAGGCCG—3ʹ. The primers for human β-actin, were up 5ʹ—GGACTTCGAGCAAGAGATGG—3ʹ, down 5ʹ—AGCACTGTGTTGGCGTACAG—3ʹ, and the obtained product 234 bp. According to the kit instructions, TGF-β1, ZEB1, and E-cadherin mRNA were detected by quantitative PCR. △Ct and the relative expression level were calculated and analyzed.
2.4 shRNA vector construction and transfectionFirst, the pSUPER-EGFP1 (enhanced green fluorescent protein 1) vector was chosen and used as the shRNA vector. Second, based on the methods of reference literature [5], the construction of the shRNA-lncRNA HOTAIR pSUPER-EGFP1 vector was conducted and proved to be correct by means of glittering gene sequencing.
The lncRNA HOTAIR shRNA sequences were as follows: Forward 5ʹ—GATCCCCGAACGGGAGTACAGAGAGATTCAAGA GATCTCTCTGTACTC CCGTTCTTTTTGGAAA—3ʹ.
The constructed pSUPER-EGFP1-shRNA-lncRNA HOTAIR (shHOTAIR) and control pSUPER-EGFP1-scramble were separately transfected into EOC SKOV3 cells. After that, the stably transfected cell lines were chosen following the plasmid biological characteristics, which included green fluorescent protein (GFP) expression and G418 resistance, so as to conduct the next functional experiments.
2.5 Transwell invasion testBased on the reference literature methods [5], the transwell Matrigel invasion assay was carried out in order to check cell invasion capability.
2.6 Tumorigenicity detectionAfter 7 days, the purchased nude mice were raised, and shHOTAIR SKOV3 and scramble-SKOV3 1 × 106 cells were inoculated into their back subcutaneous tissue. In each group, six nude mice were tested, with daily monitoring of tumor growth. Sixty days later, the tumors were removed from the nude mice.
2.7 HE and IHC detectionThe stripped xenograft tumor portions were embedded in paraffin. Afterward, hematoxylin–eosin staining (HE staining) was performed for histopathological observation. ZEB1 protein in xenograft tumors was checked by immunohistochemistry (IHC) detection. Based on the documentary methods [6], IHC detection results were determined. The nucleus stained with ZEB1 protein shows brown granules indicating positivity.
2.8 RT-qPCR in xenograft tumorsOn the basis of the aforementioned RT-qPCR, TGF-β1, ZEB1 and E-cadherin mRNA of nude mouse tumors were checked.
2.9 Statistical analysisThese experiments were repeated 3 times. Paired t tests were used to analyze the differences between the two groups. A P value of < 0.05 was considered statistically significant.
Comments (0)