Animals

Mdx mice (C57BL/10ScSn-DMDmdx/J) were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). Wild-type C57BL/6 mice were purchased from the Guangdong Medical Laboratory Animal Center (Guangzhou, China). The mice were raised in a specific pathogen-free animal facility according to standard procedures. Animal protocols were approved by the Animal Care and Experimentation Committee of Sun Yat-Sen University (SYSU-IACUC-2018-000199).

Cell preparation and fluorescence-activated cell sorting (FACS) isolation

The previously described methodology was used for isolating mouse ADSC [20]. We used C57BL/6 mice (4 weeks old) to isolate ADSC. Briefly, adipose tissue from the inguinal fat deposits of mice was carefully separated and digested using 0.1% collagenase I (Invitrogen, Carlsbad, CA, USA). The acquired cell suspension was cultured in growth media containing Dulbecco’s modified Eagle’s medium (DMEM)/F-12 (Gibco, Grand Island, NY, USA) and 10% fetal bovine serum (FBS) (Gibco).

Isolation of FAPs was performed according to the protocol of a previous study [15]. The bilateral hind limb muscles of 8-week-old mdx mice were separated and digested in media containing DMEM, 800 U/ml collagenase II (Gibco), and 0.3 U/ml dispase (Gibco). Single-cell samples were collected and incubated with the following primary antibodies (eBioscience, Grand Island, NY, USA) for 30 min at 4 °C: CD45, CD31, CD11b, Sca1, and ITGA7. Next, 7-Aminoactinomycin D (7-AAD, eBioscience) was used to identify live/dead cells. Sorting was performed on MoFlo Astrios EQs (Beckman Coulter Inc., Fullerton, CA, USA). FAPs acquired via FACS were seeded on cell culture clusters in growth media containing DMEM/F-12 medium, 20% FBS, 2.5 ng/ml bFGF (Invitrogen) on plates previously coated with Matrigel (Corning).

Adipogenic, osteogenic, and myogenic differentiation of ADSC

Adipogenic and osteogenic differentiation of ADSC has been described previously [25]. Myogenic differentiation was performed as previously described [20]. Briefly, we cultured ADSC in myogenic induction medium [DMEM containing 10% FBS, 0.5 μM BIO (Santa Cruz, Dallas, TX, USA), 20 μM forskolin (Santa Cruz), and 10 ng/ml fibroblast growth factor-basic (bFGF) (PeproTech, Rocky Hill, NJ, USA)] for 7 days. Then, we replaced it with a myogenic maintenance medium (DMEM supplemented with 2% horse serum) for further induction.

Construction of IL4 expressing plasmids and infection of lentiviral vectors

Vehicle lentivirus (pLent-EF1a- Green fluorescent protein (GFP)-P2A-Puro) and IL4-overexpressing lentivirus (pLent-EF1a-GFP-P2A-Puro-CMV-IL4) were purchased from OBiO Technology (Shanghai, China). We transduced ADSC with lentiviruses for 12 h at a multiplicity of infection (MOI) of 60 and 6 μg/mL polybrene (OBiO Technology) was used for transduction. After 72 h of transduction, we selected the transducted ADSC with 2 μg/mL puromycin for 48 h. Cells were classified into two treatment groups: ADSC transduced with vehicle lentivirus (VEH-ADSC) and ADSC transduced with IL4-overexpressing lentivirus (IL4-ADSC).

Co-culture of ADSC-derived myoblasts and FAPs

A Transwell (Corning, Midland, MI, USA) chamber with a 0.4 µm pore polyester membrane insert was used for co-culture. IL4-ADSC and VEH-ADSC inducing myogenic differentiation for 14 days were used in the co-culture study and they were digested into single cells by 0.25% Trypsin–EDTA, as previously described [20]. A similar number of ADSC-derived myoblasts and FAPs were seeded in the transwell chambers for co-culturing.

To analyze the effects of ADSC-derived myoblasts on the differentiation ability of FAPs, ADSC-derived myoblasts and FAPs were co-cultured in a myogenic maintenance medium and an adipogenic induction medium consisting of DMEM, 10%FBS and 1 μg/ml insulin for 5 days. FAPs co-cultured with ADSC-derived myoblasts, including FAPs (Co-cult with IL4-ADSC) and FAPs (Co-cult with VEH-ADSC) were used for analyzing, using mono-cultured FAPs under similar conditions as control. Besides, we added IL4 (2.4 µg/ml) to the medium consisting of DMEM, 10% FBS, and 1 µg /ml insulin for 5 days, and the group (FAPs + IL4) was then compared with mono-cultured FAPs to confirm whether IL4 influences the differentiation ability of FAPs.

To study the effect of FAPs on the myogenesis of ADSC-derived myoblasts, ADSC-derived myoblasts and FAPs were co-cultured in a myogenic maintenance medium and a medium consisting of DMEM, 10% FBS for 14 days. Following 14 days of co-culturing, the IL4-ADSC and VEH-ADSC-derived myotubes (named IL4-ADSC (Co-cult with FAPs) and VEH-ADSC (Co-cult with FAPs)) and FAPs (named FAPs (IL4-ADSC Co-cult) and FAPs (VEH-ADSC Co-cult)) in the co-culture system were used for further analysis. Transwell chambers were coated with 0.1% gelatin. The medium was changed every 2 days.

Enzyme-linked immunosorbent assay (ELISA)

IL4 levels in the cellular supernatant were analyzed via ELISA. Generally, we digested ADSC into single cells. Then, 1*106 cells were planted in a 35 mm cell culture plate (Corning), and a 2 ml culture medium or myogenic induction medium was added to each plate. The cellular supernatant of undifferentiated ADSC was collected after culturing for 24 h, and the cellular supernatants of differentiated ADSC were collected on days 14 and 28 after myogenic differentiation. All the cellular supernatants were analyzed using a Mouse IL4 Quantikine ELISA Kit (R&D Systems, Minneapolis, MN, USA) according to the manufacturer's instructions.

Cell counting kit 8 (CCK8) assays

A cell Counting Kit 8 (Abcam) was used to access the proliferation of IL4-ADSC and VEH-ADSC. Generally, 10,000 cells per well were plated in a culture microplate. Following 24, 48, and 72 h of culturing, 10 µl of CCK8 solution was added to each well (96-well plate) under dark conditions and incubated for 4 h at 37 °C. Absorbance at OD = 450 nm was measured.

Transplantation of ADSC

Eight-week-old male mdx mice were used in this study. Myogenic differentiation was induced in VEH-ADSC and IL4-ADSC for 14 days, following which these cells were digested into single cells in PBS for transplantation purposes. Next, each mdx mouse was systemically administered 2 × 106 cells in 200 μl PBS via injection into the tail vein to obtain mdx + VEH-ADSC and mdx + IL4-ADSC mice, respectively. In contrast, control mdx mice were injected with a similar volume of PBS (mdx + PBS). By contrast, wild-type C57/BL6 mice of the same age and gender were used as healthy controls. Following transplantation for 16 weeks, mice in these four groups were assessed for motor ability and then sacrificed to obtain tibialis anterior (TA) muscles, which were stored until needed for further analyses. Each group consisted of five mice (n = 5).

Protein extraction and Western blotting

Whole-cell lysates were extracted using RIPA buffer (Thermo Scientific, Waltham, MA, USA) supplemented with a protease and phosphatase inhibitor Cocktail Kit (Thermo Scientific). Protein concentration was assessed using a BCA protein assay kit (Thermo Scientific). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (8% or 10%) was used to separate soluble proteins. Next, the proteins were transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA), blocked, and incubated at 4 °C overnight with the primary antibodies: Myod1 (Santa Cruz), Myf5 (Abcam, Cambridge, MA, USA), Pax7 (Abcam), Myogenin (Abcam), MyHC (DSHB, Iowa City, IA, USA), STAT6 (CST, Danvers, MA, USA), pSTAT6 (CST), AKT (CST), pAKT (CST), ERK1/2 (CST), pERK1/2 (CST), β-Tubulin (CST), GAPDH (CST), αSMA (Sigma, St. Louis, MO, USA), Collagen III (Abcam), Collagen I (Abcam), Perilipin-1 (CST), PPARγ (CST), GFP (CST), INOS(Abcam), and CD206 (Abcam) followed by incubation with secondary antibodies for one hour at room temperature. Proteins were visualized using an enhanced chemiluminescence detection system (Thermo Fisher Scientific). Quantitative protein expression analysis was performed using Image J software (National Institutes of Health, Bethesda, MD, USA).

Immunocytofluorescence and Immunohistofluorescence

Cultured cells were washed with PBS, fixed, permeabilized with 0.3% Triton X-100 (Sigma), blocked with 1% bovine serum albumin (BSA, Sigma), and incubated overnight at 4 °C with the following primary antibodies: Pax7 (Abcam), Myod1 (Abcam), Myf5 (Abcam), Desmin (Abcam), Dystrophin (Abcam), Myogenin (Abcam), MyHC (DSHB), IL4Rα (Abcam), and PDGFRα (CST), this was followed by incubation with secondary antibodies for one hour at room temperature. The fusion index was determined as the ratio between the number of nuclei (at least two) incorporated into myotubes determined by immunodetection of MyHC and the total number. Tissue samples were sliced into serial 8-μm frozen sections. Tissue sections were fixed with cold acetone, permeabilized, and blocked as previously described, and then incubated overnight with primary antibodies against Dystrophin (Abcam), GFP (Abcam), CD206(Abcam), and INOS(Abcam) at 4 °C, followed by incubation with secondary antibodies for one hour at room temperature. Fluoroshield™ with DAPI (Sigma) was used to stain the nuclei. Immunoreactivity was visualized and imaged using a NIKANG fluorescence microscope (Olympus, Tokyo, Japan).

Quantitative polymerase chain reaction (qPCR)

Total RNA was extracted from cells using RNAiso (Takara Bio Inc., Otsu, Japan) following which cDNA was prepared using PrimeScript RT Master Mix (Takara Bio Inc.). Next, qPCR was performed using Tli RNaseH Plus SYBR Premix Ex Taq (Takara Bio Inc.) and the following forward and reverse primers: IL4, 5′-AAACGTCCTCACAGCAACGA-3′ and 5′- GCATCGAAAAGCCCGAAAGA-3′; IL-6, 5′-CCTACCCCAATTTCCAATGCTC-3′ and 5′-GGTCTTGGTCCTTAGCCACTC-3′; IGF-1, 5′-TGGCGCTCTGCTTGCTCACCTT-3′ and 5′-TAAAAGCCCCTCGGTCCACACACG-3′; Wnt1, 5′- CCCCACCTCTTCGGCAAGAT -3′ and 5′-ATGGAGCCTTCGGAGCAGGA-3′; Wnt3a, 5′-AAGTGGGGCGGCTGTAGTGA-3′ and 5′-TTCATGGCAGAGCGGGCATC-3′; Wnt5a, 5′-CCACTTGTATCAGGACCAC-3′ and 5′-TGTGCTGCAGTTCCATCTC-3′; and GAPDH, 5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′- TGGTGAAGACGCCAGTGGA-3′. GAPDH was used as an internal control.

Morphological studies

According to the manufacturer’s instructions, collagen deposition was detected via Masson’s trichrome staining (Solarbio, Beijing, China). Images were analyzed using Image J to quantify the fibrotic area-to-total area ratio. An average of five random fields of each section and three random sections of each mouse were used for the analysis. An Oil Red O stain kit (for cultured cells) (Solarbio) was used according to the manufacturer’s instructions. Images were analyzed using Image J to quantify the Oil Red O staining area. Five random detection fields were used, and three independent experiments were conducted.

Motor ability assessment

Two distinctive hanging tests were used to assess the motor abilities of the mice [26]. For the hanging test involving two forelimbs, a metal cloth hanger was tightly attached to a shelter at 37 cm above ground height. The mouse was compelled to grasp the wire with only its two forelimbs, following which the mouse was released, and the timer started. For the hanging tests involving all four limbs, the lid of a big cage meant for rats was set tightly to a shelter at a height of 25 cm above ground. Each mouse was placed on the grid with all four paws grasping it, following which inverted the grid so that the mouse was hanging and directly starting the timer. The time spent hanging was recorded as the final time taken for all hanging limbs to drop. The hanging limit was fixed at 600 s. These two hanging tests were repeated thrice for each mouse, and the longest hanging time was used for the final analysis.

Statistical analysis

Data were analyzed using SPSS (v.20.0; IBM Corp., Armonk, NY, USA) and GraphPad (v.8.0; GraphPad. Software, La Jolla, CA, USA). Normally distributed data are presented as mean ± standard deviation. The Student’s t-test and analysis of variance (ANOVA) were used to compare two groups and three or more groups, respectively. The Bonferroni test was used for comparisons between multiple groups.