Ethical statement

All animal experiments were conducted in full compliance with institutional and national ethical guidelines for the care and use of laboratory animals. Experimental protocols were reviewed and approved by the Institutional Animal Care and Use Committee of our institution. Animals were maintained under humane conditions, and all efforts were made to reduce discomfort. At the study’s conclusion, mice were euthanized using ether anesthesia to ensure minimal distress.

Cell culture

HaCaT keratinocytes and HUVECs were procured from Qingqi Biotechnology Development Co., Ltd. (BFN60803901 and BFN6021653, Shanghai, China). Cells were cultured in DMEM (10,569,010, Thermo Fisher, USA) enriched with 10% FBS (10099141C, Thermo Fisher) and 1% penicillin–streptomycin (15,070,063, Thermo Fisher). Cultures were maintained at 37 °C with 5% CO2 in a humidified incubator (Sjöqvist et al. 2019).

Isolation of HaCaT-EVs

Conditioned medium from HaCaT cultures was sequentially centrifuged to isolate EVs. Initial low-speed spins at 300 × g for 5 min (RT) and 2000 × g for 10 min (4 °C) were used to remove cells and apoptotic bodies, followed by 10,000 × g for 30 min (4 °C) to eliminate residual debris. The clarified supernatant was ultracentrifuged at 100,000 × g for 70 min (4 °C) using a Beckman Optima MAX-XP system to pellet EVs. After washing in PBS (P1020, Solarbio, Beijing, China), the pellet underwent a second ultracentrifugation under identical conditions. The final EV pellet was resuspended in PBS and stored at −80 °C until further use (Pessolano et al. 2019). Standard centrifugations were performed with a Beckman Allegra X-15R benchtop centrifuge.

Identification of HaCaT-EVs

HaCaT-derived EVs were characterized using multiple standard approaches. For nanoparticle tracking analysis (NTA), EVs were diluted 1:200 in PBS, filtered through a 0.22 µm membrane (C85052, Millipore, USA), and analyzed for size and concentration utilizing a NanoSight LM10 system (Malvern Panalytical, UK) (Lu et al. 2023).

Morphology was assessed via transmission electron microscopy (TEM). A 20 µL aliquot of fresh EV suspension was applied to carbon-coated copper grids, allowed to adsorb for 5 min, and negatively stained with phosphotungstic acid (12,501–23-4, Sigma-Aldrich, USA). After triple PBS washes and air-drying, grids were visualized using a Hitachi H-7650 TEM (Zhang et al. 2015).

EV-specific surface markers were examined by Western blot. Total protein was quantified using a BCA kit (23,227, Thermo Fisher, USA), and 50 μg was loaded per sample. Following SDS-PAGE and membrane transfer, EVs were probed with antibodies against CD9 (ab263019, Abcam, UK) and ALIX (ab232611, Abcam) as positive markers, and Calnexin (ab133615, Abcam) as a negative control to verify sample purity (Han et al. 2022).

Uptake of HaCaT-EVs by HUVECs

To assess EV internalization, purified HaCaT-EVs were labeled with the green fluorescent dye PKH67 (D0031, Solarbio, Beijing, China). The dye was prepared by diluting PKH67 in Diluent C, then incubated with EVs for 10 min (RT). Staining was halted by adding PBS with 1% FBS. Labeled EVs were co-cultured with HUVECs (3 × 105 cells) for 12 h. After incubation, cells were rinsed thoroughly with PBS to remove excess vesicles, fixed in 4% paraformaldehyde (P1110, Solarbio), and counterstained with DAPI (1:1000; D9542, Sigma-Aldrich) to visualize nuclei. Fluorescence imaging was performed using an Olympus IX73 microscope (Wang et al. 2021a, b).

Preparation of GelMA hydrogel

The GelMA hydrogel was prepared as follows: Initially, 5 g of porcine gelatin (48,722, Sigma-Aldrich, USA) were completely dissolved in preheated PBS buffer at 50 °C to achieve a solution concentration of 10% (w/v). Next, 4 ml of methacrylic anhydride (MA, 276,685, Sigma-Aldrich, USA) were slowly added to the gelatin solution, and the mixture was continuously stirred at 50 °C for 3 h. Subsequently, the solution was subjected to continuous dialysis at 40 °C for 7 days to remove impurities. After dialysis, a white foam-like GelMA precursor was obtained through freeze-drying (Modaresifar et al. 2017).

Preparation of GelMA-EVs

The extracellular vesicles isolated from keratinocyte cells were mixed into the GelMA solution described above, ensuring thorough and uniform mixing before UV cross-linking. The final concentration of the extracellular vesicles was 50 μg/mL. The composite hydrogel was then cross-linked using 365 nm UV light for 15 s to avoid compromising EV bioactivity (Yuan et al. 2022; Gao et al. 2022).

Characterization of GelMA and GelMA-EVs

The physicochemical properties of GelMA and GelMA-EVs were examined utilizing FTIR (Nicolet 6700) to confirm characteristic functional groups. Rheological behavior, including storage (G′) and loss (G″) moduli, was assessed with a Physica MCR301 rheometer (Anton Paar, China). Compressive strength was quantified using a Q800 dynamic mechanical analyzer (TA Instruments, USA), and corresponding stress–strain curves were generated for mechanical profiling (Guan et al. 2022).

Porosity and vesicle distribution

To examine microstructural features, GelMA and GelMA-EVs samples were lyophilized with an Alpha 1–2 LDplus freeze dryer (Martin Christ, Germany). Scanning electron microscopy (SEM; FEI Quanta 200, Thermo Fisher, USA) was then employed to visualize surface morphology and pore architecture. Prior to imaging, samples were sputter-coated with gold to enhance conductivity, and observed at an accelerating voltage of 20 kV (Deng et al. 2023).

Swelling behavior

Firstly, the dry weight (Wd) of photo-crosslinked cylindrical hydrogel samples was measured. Subsequently, the samples were immersed in 2 mL of PBS and incubated at 37 °C for 24 h to reach equilibrium swelling. Following removal of surface moisture, the wet weight after swelling (Ws) was measured (Hu et al. 2020). The swelling ratio can be calculated as:

Kinetics of EVs release from GelMA hydrogel

To investigate the release behavior of EVs from GelMA hydrogel, GelMA-EV composites were prepared and incubated in a PBS solution at 37 °C. The supernatant was collected at days 1, 3, 5, 7, 9, 11, and 14, and the concentration of free EVs in the supernatant was determined employing the BCA assay. Cumulative release curves and daily release curves were calculated and plotted over the specified time period (Liu et al. 2022).

Cell transfection

To simulate the diabetic environment in vitro, high glucose (33 mM glucose) was added to the HUVECs culture medium. Different experimental groups were co-incubated with the cells. Negative control (sh-NC) and PDGF shRNA (sh-PDGF) lentiviruses were procured from Genepharma (Shanghai, China). Cells were transduced with lentiviral supernatant supplemented with 5 μg/mL polybrene (TR1003, Sigma-Aldrich) following the manufacturer’s instructions. After a 24-h incubation, the medium was replaced. Forty-eight hours post-infection, transduced cells were selected using 2.5 μg/mL puromycin (540,411, Sigma-Aldrich). The following shRNA sequences were used: sh-PDGF, 5'- TGACAAGACGGCACTGAAGGA −3', and sh-NC, 5'-CCTAAGGTTAAGTCGCCCTCG-3'(Qi et al. 2021). HUVECs were co-incubated with different substances and divided into: control group with PBS, hydrogel group (GelMA), extracellular vesicles group (HaCaT-EVs), hydrogel-loaded extracellular vesicles group (GelMA-EVs). Additionally, the experimental groups and control groups of HUVECs with knocked-down PDGF gene co-incubated with GelMA-EVs were as follows: GelMA-EVs + sh-NC and GelMA-EVs + sh-PDGF. The dosage for each group was 50 μL.

Biocompatibility assessment

HUVECs (5 × 103 cells/well) were seeded into 96-well plates and exposed to different samples for 24 h. Cell viability was tested utilizing a live/dead staining kit (C2015M, Beyotime, China). After adding 100 μL of staining solution, cells were incubated at 37 °C in the dark for 30 min and imaged via fluorescence microscopy (Chen et al. 2023).

Proliferation assay

To evaluate the effect of EVs on HUVEC proliferation, the CCK-8 assay kit (96,992, Sigma-Aldrich, USA) was used to assess cell viability. HUVECs (5 × 103 cells/well) were seeded in a 96-well plate and incubated for 24 h before treatment with EVs. After adding 10 μL of CCK-8 reagent to each well, the plate was incubated at 37 °C for 2 h. The optical density (OD) of the samples was measured at 450 nm using an ELISA reader (Bio-Rad 680, Hercules, USA) (Chen et al. 2018).

Functional evaluation of HUVEC migration and angiogenic capacity

To investigate the functional impact of different treatments on endothelial behavior, HUVEC migration and tube formation were assessed using scratch, Transwell, and Matrigel-based assays.

For the scratch assay, confluent HUVEC monolayers (5 × 105 cells/well) were scratched with a pipette tip, washed, and incubated in serum-free medium with treatments. Migration was imaged at 0 and 24 h using an inverted microscope (TE2000, Nikon) (Glady et al. 2021)..

In the Transwell assay, HUVECs were seeded in the lower chamber, while treated serum-free medium was added to the upper chamber. After 24 h, migrated cells were fixed, stained with crystal violet, and quantified under a microscope (Olympus IX70) using ImageJ (Dai et al. 2022).

For the tube formation assay, Matrigel-coated wells (50 μL/well, 356,234, Corning, Shanghai, China) were seeded with HUVECs (1 × 104 cells/well) and incubated for 6 h. Tubule structures were visualized and analyzed with ImageJ (Gong et al. 2022).

In Vivo animal experimentation diabetic Wound healing mouse model

Male C57BL/6 mice (8–10 weeks old) were obtained from Vital River Laboratories (101, Beijing, China). The mice were fasted for 12 h prior to modeling. Diabetes was induced by intraperitoneal injection of streptozotocin (STZ) (50 mg/kg) (S8050, Solarbio, Beijing, China). STZ was dissolved in freshly prepared citrate buffer (0.1 mol/L, pH 4.5) (C1013, Solarbio, Beijing, China) in order to prepare a 1% STZ solution, thus avoiding acute STZ toxicity. The injection was performed for 4 consecutive days. On the 12th day after the STZ injection, blood glucose was examined utilizing the Accu-Chek Performa glucometer (Roche, Switzerland) to confirm the hyperglycemic state (up to 200 mg/mL). From the 12th day after the STZ injection, fasting blood glucose was measured twice a week. When blood glucose levels remained above 16.7 mmol/L for 3 consecutive days, the successful construction of the diabetic mouse model was confirmed (Pomatto et al. 2021).

Mice were anesthetized using 3% isoflurane (792,632, Sigma-Aldrich, USA) inhalation. The dorsal area was disinfected using 10% povidone-iodine, and a full-thickness skin wound of 1 × 1 cm2 was created using a multipoint injection technique at the wound edge. The mice were randomized into control group treated with PBS, hydrogel group treated with GelMA, extracellular vesicle group treated with HaCaT-EVs, hydrogel-loaded extracellular vesicle group treated with GelMA-EVs. The infected sh-NC group without GelMA-EVs treatment served as the control group (sh-NC), GelMA-EVs-treated and sh-NC-infected group (GelMA-EVs + sh-NC), and GelMA-EVs-treated and sh-PDGF-infected group (GelMA-EVs + sh-PDGF). Each group consisted of 30 mice (Table 1). Injections of 100 μL were administered every 3 days within 14 days after the skin injury. Digital photographs of the wounds were taken daily using a Canon camera (Japan), and ImageJ software was utilized to analyze changes in wound area to monitor wound healing time and area reduction (Wei et al. 2020).

Table 1 Experimental Grouping, Treatment, and Sample SizeObservation of organizational changes

Skin samples taken from mice were immediately fixed in 4% paraformaldehyde for at least 24 h. The fixed samples were then dehydrated with a gradient of ethanol, clarified in bright isopropanol, and finally, consecutive sections with a thickness of 5 µm were obtained utilizing a paraffin microtome.

H&E Staining

Paraffin-embedded tissue sections were baked at 60 °C for 1 h, deparaffinized with xylene, and stained using standard hematoxylin (10 min) and eosin (2 min) protocols. After mounting, tissue morphology was examined under a light microscope. Reepithelialization was quantified utilizing the formula E% = (Wn/Wo) × 100, where Wo is the initial wound width and Wn is the length of regenerated epithelium(Yang et al. 2020).

Masson's Trichrome Staining

The sections were dried in an oven at 65 °C for 2 h and underwent routine deparaffinization and dehydration. They were stained with hematoxylin for 8 min and rinsed with distilled water. Subsequently, they were stained with 1% Ponceau S for 10 min. After a brief immersion in 2% acetic acid, the reaction was terminated with 1% phosphomolybdic acid solution. Without washing, the sections were directly stained with aniline blue for 2 min. Routine dehydration was performed, followed by mounting with transparent neutral resin (Wang et al. 2021a, b). Tissue sections were observed, and images were captured under an optical microscope, paying attention to significant features associated with epithelialization, neovascularization, and collagen fiber deposition. The average intensity of Masson's staining was examined utilizing Image-Pro Plus 6 software from randomly selected fields (at least 3).

Immunofluorescence Staining

After hydration of paraffin sections, they were blocked with 1.5% goat serum. The sections were then incubated with α-SMA antibody conjugated with Fluor 488 (488 53–9760-80, 1:200, Thermo Fisher, USA) and CD31 antibody conjugated with APC (17–0311-80, 1:500, Thermo Fisher, USA). DAPI (1:1000) was used to stain the nuclei. Stained sections were observed under a fluorescence microscope, and the density of blood vessels and positive cells were quantified using Image-Pro Plus 6 software from randomly selected fields (at least 3) (Ren et al. 2022).

Microvascular imaging

Microvascular assessment at the wound site was implemented utilizing the IVIS Spectrum imaging system (PerkinElmer, USA). Mice were lightly anesthetized, and transparent tape was applied around the wound to minimize signal interference. Imaging was performed per manufacturer’s protocol, and data were analyzed using Living Image software (PerkinElmer) (Zhou et al. 2023).

RT-qPCR

Total RNA was extracted from mouse skin tissues and cultured cells utilizing TRIzol reagent (10,296,010, Thermo Fisher, USA), followed by reverse transcription with the PrimeScript™ RT kit (RR086A, TaKaRa, Japan). qPCR amplification was implemented utilizing SYBR® Premix Ex Taq™ II (DRR081, TaKaRa) on an ABI 7500 system (Thermo Fisher, USA). GAPDH served as the internal control. Reactions were run in triplicate, and gene expression levels were quantified utilizing the 2−ΔΔCt method (Wang et al. 2018). Primers (Table S1) were synthesized by Shanghai Simgen Bio. Each experiment was independently repeated three times.

Western blot

Total protein was extracted from cells or tissues using a commercial lysis kit (BB3101, Bestbio, Shanghai) with enhanced RIPA buffer enriched with protease inhibitors (AR0108, Boshide, Wuhan). Protein concentrations were determined using a BCA assay (23,227, Thermo Fisher, USA). Equal amounts of protein (50 μg) were resolved on 10% SDS-PAGE gels (P0012A, Beyotime) and transferred to PVDF membranes (IPVH00010, Millipore) at 250 mA for 90 min. Membranes were blocked with 5% skim milk in TBST for 4 h (RT), followed by overnight incubation at 4℃ with primary antibodies (Table S2) prepared in 5% BSA/TBST. After washing, membranes were incubated with HRP-conjugated secondary antibodies (Anti-Mouse, #7076; Anti-Rabbit, #7074; CST, 1:5000) for 1 h. Protein bands were visualized using enhanced chemiluminescence (P0018FS, Beyotime) and imaged in a darkroom. Band intensities were quantified with ImageJ software, normalized to GAPDH as a loading control (Luo et al. 2019; Lu et al. 2018).

Sequencing and initial data processing

Total RNA was extracted using TRIzol and dissolved in DEPC-treated water. RNA purity (A260/280 between 1.8–2.1) was assessed via NanoDrop, and integrity was confirmed with an Agilent Bioanalyzer (RIN ≥ 7). Ribosomal RNA was depleted, and sequencing libraries were constructed using NEB or Illumina kits, involving RNA fragmentation, adaptor ligation, and quality validation via Qubit and Bioanalyzer.

Sequencing was performed on Illumina HiSeq or NovaSeq platforms. Raw reads were quality-checked using FastQC (Q30 > 90%), and adapters/low-quality reads were trimmed using Trim Galore or Trimmomatic. Clean reads were aligned to the reference genome using HISAT2 or STAR, with mapping efficiency exceeding 90%.

Differential expression analysis was carried out in R (v4.2.1) using the limma package, applying thresholds of |log2FC|> 1 and P < 0.05. Heatmaps and volcano plots of differentially expressed genes (DEGs) were visualized using the heatmap and ggplot2 packages, respectively (Liu et al. 2018).

Statistical analysis

Data were analyzed using GraphPad Prism 8 (v8.0.2) and SPSS 21.0 (SPSS Inc., USA). Continuous variables were summarized as mean ± SD. Group comparisons were implemented utilizing unpaired t-tests (two groups) or one-way ANOVA (multiple groups), while two-way ANOVA was applied for time-course data. Categorical data were analyzed utilizing the chi-square test. Statistical significance was set as P < 0.05.