Primary ciliary dyskinesia (PCD) is a rare, autosomal recessive disorder caused by impaired cilia and flagella function. Despite advances in molecular diagnostics, pathogenic variants remain to be detected in a subset of clinically diagnosed individuals. In the present case, abdominal ultrasonography revealed situs inversus of the liver and spleen, and chest X-ray demonstrated dextrocardia. Semen analysis showed markedly reduced sperm motility, consistent with ciliary dysfunction, and the patient exhibited additional clinical features characteristic of PCD. Exome sequencing (ES) revealed biallelic variants in dynein axonemal assembly factor 1 (DNAAF1) (NM_178452.6), including a missense variant, c.524T>C (p.Leu175Pro), and a nonsense variant, c.1462C>T (p.Arg488*). Segregation analysis was performed in the available family members and confirmed that each parent carried one of the variants in a heterozygous state. Bioinformatic predictions supported the pathogenic potential of identified variants, suggesting that they likely underlie the ciliary defects observed in the affected individual. Taken together, these findings implicate previously reported DNAAF1 variant c.1462C>T and newly identified variant c.524T>C in PCD associated with male infertility. The predicted structural perturbation in DNAAF1 protein structure is likely to impair dynein arm assembly, leading to loss of ciliary motility and the resultant clinical phenotype.
IntroductionCilia are hair-like protrusions of the plasma membrane and represent essential cellular organelles with diverse functions. They play critical roles in airway mucus clearance (Bustamante-Marin and Ostrowski, 2017), cerebrospinal fluid circulation (Faubel et al., 2016; Kumar et al., 2021), leftward extraembryonic fluid flow in the embryonic node (Hirokawa et al., 2006; Shinohara et al., 2012), and movement of the sperm (Yuan et al., 2019) and fertilized ovum (Suarez and Wolfner, 2021; Yuan et al., 2021). The majority of vertebrate cell types express a single immotile sensory primary cilium. However, multiple specialized motile cilia are present on differentiated epithelial cell-types of the brain, respiratory tract, sperm and fallopian tubes. Dysfunction of motile cilia has emerged as the cause of severe defects collectively termed primary ciliary dyskinesia (PCD; MIM 244400), a rare disorder affecting approximately 1 in 10,000–20,000 live births with an estimated incidence of 1 in 7,500 to 1 in 30,000 (Mianné et al., 2018; Lucas et al., 2020; Wee et al., 2024). PCD is characterized by chronic respiratory tract infection (Tilley et al., 2015), situs inversus (Pennekamp et al., 2015) and hydrocephalus (Munch et al., 2025), wherein infertility is a frequent comorbidity. To date, more than 50 genes have been implicated in PCD, with approximately 15–20 of these specifically associated with significant fertility defects, particularly affecting male reproductive function (Ji et al., 2017; Roostaei et al., 2025).
Infertility is a global health problem that affects 15% of couples, and 20%–30% of cases are related to men (Agarwal et al., 2015; Mehra et al., 2018). Male infertility represents a highly heterogeneous pathological condition that affects approximately 7% of the male population (Bracke et al., 2018). Male infertility is generally recognized only after the onset of puberty, systematic assessment of sperm parameters is rarely performed in individuals with known PCD (Jayasena and Sironen, 2021). Consequently, existing documentation of male reproductive outcomes remains incomplete, and the specific contributions of PCD-associated genes to human flagellar function are still insufficiently defined.
The axoneme, the core of motile cilia and flagella, consists of nine peripheral outer doublet microtubules surrounding a central microtubule pair. Along each doublet, there are inner and outer dynein arms that hydrolyze ATP to power ciliary movement, radial spokes that modulate ciliary beating (Castleman et al., 2009), and a spoke-associated dynein regulatory complex (Heuser et al., 2009). Axonemal dynein is attached to the doublet microtubules in two main continuous rows known as the outer dynein arm (ODA) and the inner dynein arm (IDA). ODAs and IDAs are connected to the α-microtubule of each peripheral doublet for driving the sliding of the microtubule doublets (Pazour et al., 2006). While the composition of dynein arms varies among species, human respiratory cilia possess ODAs composed of a globular head domain containing the heavy chains HCβ (DNAH11/DNAH9) and HCγ (DNAH5), an intermediate domain formed by DNAI1 and DNAI2, and a docking complex comprising CCDC114, CCDC151, ARMC4, and TTC25, which secures the ODA to the adjacent microtubule doublet (Fliegauf et al., 2005; Nicastro et al., 2006). Variants in genes encoding dynein assembly factors, radial spoke components, components of the ODA and dynein regulatory complex have all been shown to cause PCD with laterality defects and male infertility (Loges et al., 2008; Ji et al., 2017; Whitfield et al., 2019; He et al., 2023).
DNAAF1 (MIM: 613193, known as LRRC50) is located on chromosome 16q24.1 and contains 12 exons, encoding a protein containing 725 amino acids. DNAAF1, the human ortholog of Chlamydomonas ODA7, functions as a dynein assembly factor, and variants in ODA7/DNAAF1 impair dynein arm assembly, leading to reduced ciliary beat frequency (Freshour et al., 2007). Mutants of dnaaf1,the zebrafish ortholog of human DNAAF1, exhibit classic motile cilia phenotypes, including pronephric cysts, and randomized heart jogging and visceral laterality defects in over 50% of embryos (Sullivan-Brown et al., 2008; van Rooijen et al., 2008). The DNAAF1 mutants have ultrastructural abnormalities of the dynein arms (lacking either ODA, or both IDA and ODA) and outer microtubule misalignment (Basten et al., 2013). In human respiratory epithelia, DNAAF1 variants result in the absence of key dynein subunits from the ciliary axoneme, confirming its essential role in dynein preassembly (Loges et al., 2009). Currently, the studies reported DNAAF1 variants, primarily focusing on the classic PCD phenotypes including situs invervus (Loges et al., 2009; Zhou et al., 2020), bronchiectasis (Ito et al., 2024) and neural tube defects (Miao et al., 2016). In addition, one study identified a DNAAF1 variant in a patient with seminoma (Basten et al., 2013). However, evidence linking DNAAF1 variants to reproductive dysfunction remains limited and inconclusive.
In this study, we investigated a patient with primary ciliary dyskinesia and male infertility to identify the underlying genetic cause and characterize the functional consequences of DNAAF1 variants. By combining exome sequencing, in silico structural modeling using AlphaFold, and functional assays in human cell lines, we aimed to elucidate how DNAAF1 variants affect protein structure, stability, and dynein arm assembly. This work provides new insights into the genotype–phenotype correlations of DNAAF1 and expands our understanding of its critical role in ciliary motility and male reproductive health.
Materials and methodsEthical complianceInformed consent was obtained from the patient prior to study enrollment. The research was approved by the Ethics Committee of Ganzhou Maternal and Child Health Hospital (Approval No. 2024-103, 15 November 2024). All procedures were performed in accordance with the ethical standards of the institutional and national research committees, as well as with the declaration of Helsinki.
Sample collection and DNA extractionPeripheral venous blood samples were taken from the proband and all available family members following the acquisition of informed consent from all participants. Genomic DNA was extracted using the QIAamp DNA Mini Kit for blood (Qiagen, Hilden, Germany), as previously described (Liao et al., 2025b; 2025a; Xie et al., 2025). DNA quality and integrity were assessed by agarose gel electrophoresis, and concentrations were measured using Qubit 2.0. A minimum of 1.5 μg of high-quality DNA from the proband was used for library preparation.
Library preparation and exome sequencingExome sequencing (ES) was performed by Kangxu Diagnostics (Beijing, China). Genomic DNA was fragmented to 180–280 bp, followed by end repair, A-tailing, and adapter ligation with unique indexes. Libraries were pooled and hybridized to the NEXome Core Panel to capture the exons of over 20,000 genes. Captured fragments were PCR-amplified and quality-checked using Qubit quantification, Agilent 4150 insert size analysis, and qPCR. Libraries that passed the quality control (QC) were sequenced on the BGISEQ-T7 platform to an average depth of 100×, and coverage metrics, including the proportion of target bases ≥20×, were assessed. Raw sequencing data were generated in FASTQ format.
Variant analysisSequencing data were converted from BCL to FASTQ using bcl2fastq (v2) and aligned to the human reference genome (hg19) with BWA (v0.7.15). SNVs and small insertions/deletions were identified using GATK (v3.6), while CNVs were analyzed with CODEX, XHMM (v1.0), and KSCNV (developed by Kangxu Diagnostics). Variants were annotated with ANNOVAR (v2016-02-01) for gene/transcript position, protein impact (PolyPhen2 (http://genetics.bwh.harvard.edu/pph2/), SIFT (https://sift.bii.a-star.edu.sg/index.html),MutationTaster(https://www.mutationtaster.org/)), disease associations (OMIM, HGMD, ClinVar), and population allele frequencies (1000G, ESP6500, gnomAD). Variant screening integrated clinical phenotypes, population and disease databases, and functional prediction tools, with extremely rare variants identified (c.524T>C: gnomAD_exome AF = 0.00000136809; c.1462C>T: AF = 0.0000219618). Variants were filtered and prioritized based on genomic location, type, rarity (MAF <1%), predicted functional impact, and known disease associations, then classified according to ACMG/AMP guidelines.
Sanger sequencing verificationCandidate gene variants identified by exome sequencing in the proband were validated by Sanger sequencing. Gene sequences for the candidate variants were obtained from the GenBank database, and primers were designed using Primer Z (http://genepipe.ncgm.sinica.edu.tw/primerz/primerz4.do) and subsequently synthesized. PCR amplification of the candidate variant sites was performed using the following primers: DNAAF1 F1: GGCAAAAACAAGGGTGACCG, DNAAF1 R1: TCAGGGGAAGGTGATGGACA, DNAAF1 F2: GGGGACAGAGAAACAAGGCA, and DNAAF1 R2: GTCCCACAGAGACGTGAGTC. PCR products were verified on 1% agarose gel, purified, and subjected to Sanger sequencing on an ABI 3730 DNA analyzer. Sequencing results were analyzed and aligned to the reference sequences to validate variants and exclude potential false positives identified in prior next-generation sequencing.
DNAAF1 plasmid constructsFull-length DNAAF1 cDNA sequences, including the wild-type (WT) and the variants c.524T>C and c.1462C>T, were synthesized and cloned into the pCDNA3.1 expression vector containing an N-terminal His tag, generating pCDNA3.1-DNAAF1-WT, pCDNA3.1-DNAAF1-mut1, and pCDNA3.1-DNAAF1-mut2, respectively. The primers used for the synthesis of these cDNAs are listed in Supplementary Table S1. The WT and mutant cDNAs were inserted into the pCDNA3.1 vector using the restriction enzymes KpnI and XbaI, followed by ligation with T4 DNA ligase (Thermo Fisher Scientific, USA). Recombinant plasmids were isolated from individual bacterial colonies and screened by restriction enzyme digestion to verify the presence of inserts of the expected size. The sequence integrity and correctness of all constructs were further confirmed by sequencing.
Cell culture and transfectionHEK293 cell lines (American Type Culture Collection, ATCC) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) sourced from GIBCO Life Technologies. The medium was supplemented with 10% fetal bovine serum (FBS) from Invitrogen, 100 U/mL penicillin-streptomycin (GIBCO Life Technologies), and 2.5 μg/mL Plasmocin (InvivoGen). Cells were incubated at 37 °C in a humidified environment with 5% CO2. Transfections were performed using Lipofectamine 2000 (Invitrogen, Burlington, ON, Canada), followed by a 48-h incubation prior to western blot analysis.
Western blotCell samples were collected and lysed in sodium dodecyl sulfate (SDS) loading buffer, followed by heating at 100 °C for 5 min. Proteins were separated by SDS-PAGE and subsequently transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with Tris-buffered saline (TBS) containing 0.1% Tween-20% and 5% skimmed milk for 1 h at room temperature to minimize nonspecific binding. Membranes were then incubated overnight at 4 °C with primary antibodies: His-Tag monoclonal antibody (Proteintech, Cat. No. 66005-1-Ig, 1:1000) and GAPDH rabbit monoclonal antibody (Abclonal, Cat. No. A19056, 1:1500). Following three washes with TBST (10 min each), membranes were incubated for 1 h at room temperature with HRP-conjugated secondary antibodies: goat anti-mouse IgG (H + L) (Thermo Fisher, Cat. No. 31430) and goat anti-rabbit IgG (H + L) (Thermo Fisher, Cat. No. 31460), both diluted 1:10,000. After three additional washes with TBST, protein signals were visualized using an enhanced chemiluminescence (ECL) detection substrate.
Protein structure predictionThe protein sequence with 725 amino acid residues of DNAAF1 was downloaded from uniprot web (UniProt accession Q8NEP3, https://www.uniprot.org/). Wild-type and mutant DNAAF1 proteins, corresponding to c.524T>C (p.Leu175Pro) and c.1462C>T (p.Arg488*), were modeled in 3D using the AlphaFold web server https://golgi.sandbox.google.com/about) (Abramson et al., 2024a). The best model was selected based on pLDDTs prediction scores. The higher the score, the more confident is the structure. Prediction models editing was performed and visualized using PyMOL program (https://pymol.org/).
Bioinformatics analysisThe protein-protein interaction (PPI) network associated with DNAAF1 was constructed using STRING (https://string-db.org/). The amino acid sequence of the DNAAF1 protein, comprising 725 residues, was retrieved from the UniProt database (https://www.uniprot.org/). This sequence was used as the input query for STRING, where the parameters were set to ensure high-confidence interactions were captured. The confidence score threshold was adjusted to include only interactions supported by strong evidence such as experimental data, co-expression, and co-occurrence analyses.
ResultsHeterozygous variants of DNAAF1 identified in a patient with male infertility and PCDThe affected individual (II3-4) presented to the hospital for assisted reproductive technology (ART) treatment due to severely reduced sperm concentration, motility, and overall semen quality, consistent with profound male factor infertility. Exome sequencing of the proband identified two heterozygous variants in DNAAF1: c.524T>C, a previously unreported missense variant, and c.1462C>T, a variant previously reported in seminoma (Basten et al., 2013). Sanger sequencing confirmed these variants and demonstrated that each parent carried one heterozygous allele, consistent with compound heterozygosity in the proband (Figures 1A,B). Abdominal ultrasonography and chest computed tomography (CT) revealed situs inversus, including complete reversal of the heart, spleen, and liver, whereas a healthy control exhibited normal organ positioning (Figure 1C). The c.524T>C variant is a missense variant located in exon 4, while the c.1462C>T variant is a nonsense variant located after exon 8, predicted to produce a truncated protein. Multiple sequence alignment showed that the affected residue corresponding to c.524T>C is highly conserved across species, highlighting its likely functional importance (Figure 1D). Collectively, these clinical observations, together with the identified DNAAF1 variants, provide a genetic and phenotypic explanation for the patient primary ciliary dyskinesia with male infertility and laterality defects.

Identification of DNAAF1 Variants in a Patient with Primary Ciliary Dyskinesia and Male Infertility. (A) Pedigree and Segregation analysis of DNAAF1 variants in family. (B) The identified variants were confirmed by Sanger sequencing. (C) Abdominal ultrasonography and chest computed tomography images of the affected individual (II2) and a control. R, right; L, left; Sp, spleen; LK, left kidney; LI, liver; RK, right kidney. (D) Approximate locations of the identified variants and evolutionary conservation of the corresponding amino acids. Multiple sequence alignment of human DNAAF1 with orthologues from other species is shown.
Predicted structural and functional consequences of DNAAF1 variantsTo investigate the potential structural impact of the identified DNAAF1 variants, three-dimensional protein structures were predicted using the AlphaFold web server (https://golgi.sandbox.google.com/about) (Abramson et al., 2024b), which generates accurate structural models based on amino acid sequence information. The predicted structure of the wild-type DNAAF1 protein revealed that Leu-172 and Leu-175 form stabilizing hydrogen bonds, maintaining the integrity of the leucine-rich repeat (LRR) domain. The c.524T>C missense variant substitutes Leu-175 with proline, disrupting the hydrogen bond network and locally altering the charge distribution, which may affect domain stability and protein–protein interactions (Figure 2A). In contrast, the c.1462C>T variant introduces a premature stop codon, resulting in a truncated protein of 488 amino acids, with loss of critical C-terminal domains required for dynein arm and radial spoke interactions (Figure 2B). These AlphaFold-based structural predictions suggest that c.524T>C may cause subtle conformational perturbations, whereas c.1462C>T likely induces severe structural disruption, consistent with a loss-of-function effect.

Predicted structural consequences of DNAAF1 variants. (A) Predicted three-dimensional structure of the wild-type DNAAF1 protein. Leu-172 and Leu-175 form hydrogen bond interactions. The c.524T>C variant changes Leu-175 to Pro-175, disrupting the original hydrogen bond without forming new ones, leading to a local alteration in charge distribution. (B) Predicted structure of the c.1462C>T mutant DNAAF1 protein, resulting in a truncated protein comprising 488 of the 725 amino acids of the mature protein. (C) Expression of DNAAF1 WT and mutant proteins in HEK293 cells. GAPDH is used as a loading control. Protein expression of DNAAF1 c.524T>C was comparable to the wild type, whereas DNAAF1 c.1462C>T exhibited a truncated protein with a lower molecular weight. (D) Schematic representation of DNAAF1 showing the localization of the identified variants within functional domains. DNAAF1 contains leucine-rich repeats (LRRs), a leucine-rich repeat C-terminal domain (LRRCT), a proline-rich region, and coiled-coil domains. The c.524T>C variant is located within the LRRs, while the c.1462C>T variant is situated in the proline-rich region, indicating their potential impact on protein structure and function.
DNAAF1 mutant protein expression analysisThe c.1462C>T variant in DNAAF1 is a nonsense variant predicted to generate a truncated protein due to premature termination of translation. To determine whether these mutant alleles could produce stable, intact DNAAF1 protein, we constructed expression plasmids carrying either wild-type or mutant DNAAF1 sequences and transiently transfected them into HEK293T cells. Protein expression levels were subsequently evaluated by western blot using an anti-His antibody specific to the recombinant proteins. The results demonstrated that the c.1462C>T mutant exhibited markedly reduced molecular weight relative to WT, consistent with the predicted truncation and potential instability of the protein. In contrast, the c.524T>C missense variant did not substantially affect protein expression (Figure 2C) (Supplementary Figure S1). Domain mapping showed that c.524T>C resides within the leucine-rich repeats (LRRs), whereas c.1462C>T lies in the proline-rich region, indicating potential disruption of domain-specific functions contributing to defective dynein arm assembly and the observed ciliary dysfunction. (Figure 2D).
Genotype-phenotype relationship in DNAAF1To investigate the factors underlying phenotypic variability in DNAAF1-associated PCD and infertility, we systematically reviewed all reported DNAAF1 variants and analyzed their associated clinical features. Reported pathogenic and likely pathogenic variants (Table 1) distributed across key functional domains of the DNAAF1 protein, including the leucine-rich repeat (LRR) domains and the proline-rich region. To better understand genotype-phenotype correlations, the reported clinical data on DNAAF1 variants were collected, including variants c.811T and c.1349_1350insC (Loges et al., 2009), c.691A > C (Miao et al., 2016), c.571C > T (Hartill et al., 2018), c.524T>G (Duquesnoy et al., 2009), c.943A>T, c.3G>A, c.124 + 1G>C, c.509delG and c.943A>T (Zhou et al., 2020), as well as c.86delG (Ito et al., 2024) (Table 2). DNAAF1 variants are associated with a spectrum of PCD phenotypes, most commonly involving respiratory dysfunction.DNAAF1 variants are also linked to the laterality defects, including totalis and partial situs inversus, as well as certain congenital heart defects, which could be detected during pregnancy. These findings further support DNAAF1 as a causative gene in PCD with infertility and emphasizes the various clinical symptoms caused by different variant types.
MutationHGMD access IDAmino acid changeLocation on DNAFF1DiseasePMIDPathogenicity326A>GCM2227736Asn-SerLRR1Rett syndrome36157478Pathogenic371A>GCM1611688Asn-SerLRR1Neural tube defects27543293Pathogenic524T>GCM099261Leu-ArgLRR4Primary ciliary dyskinesia19944405Likely pathogenic524T>CNDLeu-ProLRR4Primary ciliary dyskinesiaNDLikely pathogenic571C>TCM182762Leu-PheLRR4Heterotaxy29228333Pathogenic604A>GCM1618864Met-ValLRR5Multiple congenital anomalies26633542Pathogenic628G>ACM2077928Val-MetLRR5Developmental disorder33057194Pathogenic683C>TCM2125649Ser-LeuLRR6Primary ciliary dyskinesia34556108Pathogenic691A>CCM1611689Lys-GlnLRR6Neural tube defects27543293Pathogenic1294G>ACM129169Glu-LysPro richPrimary ciliary dyskinesia22499950Pathogenic1300G>ACM2219220Gly-ArgPro richPrimary ciliary dyskinesia35804324Pathogenic1303G>ACM1910538Asp-AsnPro richPrimary ciliary dyskinesia31213628Pathogenic1462C>TNDArg-*Pro richPrimary ciliary dyskinesiaNDLikely pathogenicMutations described in the DNAAF1 gene (from the Human Gene Mutation Database).
DescriptionThis studyDuquesnoy et al. (2009)Tomas et al. (2009)Miao et al. (2016)Hartill et al. (2018)Zhou et al. (2020)Ito et al. (2024)Mutationc.524T>C, c.1462C>Tc.524T>Gc.811T,Clinical data of all DNAAF1 mutations in patients with primary ciliary dyskinesia.
(+), present; (–), absent.
Impact of DNAAF1 variants on dynein arm assemblyDNAAF1 is broadly expressed across multiple tissues, with relatively high expression in ciliated tissues like brain, cervix, fallopian tube, lung and testist (Figure 3A). The expression of DNAAF1 was obtained from the GTEX (https://gtexportal.org/home/). Subcellular localization analysis indicates that DNAAF1 is highly enriched in the axoneme, including both 9 + 0 non-motile cilia and 9 + 2 motile cilia, particularly within the outer dynein arms (ODA) and inner dynein arms (IDA) (Figure 3B). Gene ontology analysis of biological processes suggest that DNAAF1 is involved in axoneme assembly, axonemal dynein arm assembly, and ODA assembly, all of which are critical for ciliary motility (Figure 3C). The data were derived from STRING database analysis (https://string-db.org/). To further investigate DNAAF1 function, STRING database was employed to examine potential functional interactions, revealing that DNAAF1 interacts with ODA subunits DNAH5, DNAH11, DNAI1, and DNAI2, as well as the IDA subunit DNALI1 (Figure 3D).

The predict effect of DNAAF1 mutants on the dynein assembly. (A) GTEx data demonstrate that DNAAF1 is expressed at an appreciable level in human tissue represented. (B,C) Subcellular localization and biological pathway of DNAAF1. (D) DNAAF1 protein-protein interactions using STRING software. (E) The impact of DNAAF1 mutants on these protein-protein interactions, showing potential disruption of binding with ODA and IDA subunits. The purple structure represents the wild-type DNAAF1 protein, while the grey regions correspond to the portions absent in the c.1462C>T variant. The green structures depict DNALI1, DNAI1, and DNAI2.
Using AlphaFold3, we modeled the DNAAF1–DNALI1 and DNAAF1–DNAI1 complexes and found that the DNAAF1–DNAI1 interface exhibits a substantially broader and more continuous surface-binding region compared with the DNAAF1–DNALI1 interface (Figure 3E). The grey regions correspond to the portions that are absent in the c.1462C>T variant. The c.1462C>T (p.Arg488*) substitution was also predicted to markedly disrupt the local binding interface between DNAAF1 and DNALI1. As indicated by the structural model with enlarged diagrams, this variant perturbed the surrounding residue geometry and eliminated stabilizing hydrogen-bond interactions normally formed within this region. As a consequence, the variant impaired the formation and stabilization of hydrogen bonds with neighboring residues that were essential for maintaining the DNAAF1–DNALI1 and DNAAF1–DNAI1 binding interface.
Together, these structural alterations strongly suggested that the c.1462C>T variant compromised DNAAF1’s ability to interact with its dynein arm subunits ultimately impairing the pre-assembly of both ODA and IDA components. This provided a mechanistic explanation for the defective dynein arm formation and ciliary dysfunction observed in patient with this variant.
DiscussionCilia are highly specialized cellular organelles whose architecture and motor machinery determine their biological roles. Among them, motile cilia exhibit the canonical “9 + 2” axonemal structure, composed of nine outer microtubule doublets surrounding a central pair (Mitchell, 2004; Loreng and Smith, 2017). Attached to the outer doublets are the outer dynein arms (ODAs) and inner dynein arms (IDAs), which function as ATP-dependent motor complexes that drive coordinated, rhythmic beating (Lin and Nicastro, 2018; Ishibashi et al., 2020; Leung et al., 2025). ODAs primarily regulate the frequency of ciliary motion, while IDAs are important for the waveform of the cilium (Brokaw and Kamiya, 1987; Kubo et al., 2021). Defects affecting one or both dynein arm components are key contributors to PCD (O’Callaghan et al., 2011; Reiter and Leroux, 2017), a genetically heterogeneous disorder with a well-characterized phenotype but no effective treatment (Mianné et al., 2018; Lee and Ostrowski, 2021)
Comments (0)