Animals

The C57BL/6J wild-type (WT) mice used in this study were procured from Hunan Slack Jingda Laboratory Animal Co., Ltd, China (usage certificate number: SCXK 2019-0004). The global S100A9 heterozygotes (S100A9+/−) mice were provided by Cyagen Biosciences Inc. (Suzhou, China). The S100A9 heterozygote mice were bred together to produce homozygotes S100A9 KO mice (S100A9−/−) (Supplemental Fig. 1). Genotyping of mice was performed using polymerase chain reaction (PCR) with tail deoxyribonucleic acid (DNA) according to the manufacturer’s instructions. The genotyping primers for S100A9 KO were as follows: forward (F) (5′-GTATATGTGGAGGGAAGCTGTCTC-3′) and reverse (R) (5′- GTGAAAGGAGGCAGAAAGGACATG-3′). The genotyping primers for S100A9 WT were as follows: F (5′-CAAAGTCCTAGTGCCCACGGC-3′) and R (5′-GTGAAAGGAGGCAGAAAGGACATG-3′). All mice were housed under controlled conditions with a temperature of 23.6℃, a relative humidity of 68.1%, a 12-h light/dark circle, and food and water ad libitum at the Experimental Animal Centre of Chongqing Medical University. All animal procedures were approved by the Animal Care and Use Committee of Chongqing Medical University and performed in accordance with the National Institutes of Health Guidelines for the Use of Laboratory Animals.

Cecal ligation and puncture operation

Male WT and S100A9 KO mice, aged 8-10 weeks, were randomly selected for the experiments. The polymicrobial sepsis model was induced using the cecal ligation and puncture (CLP) technique as described previously [23,24,25]. The mice were anesthetised with a 1% pentobarbital sodium (0.05 mL/10g) solution. A 1-cm midline laparotomy was performed, and the abdomen was shaved. The cecum was exposed, and a tight ligation was applied to its middle portion using a 4-0 silk suture. The cecum was then perforated twice using a 21-gauge needle, and slight pressure was applied to extrude 1 mm of faecal matter from each puncture hole. Finally, the cecum was returned to the central abdominal cavity. The abdominal incision of the mice was closed, and 1 mL of sterile 0.9% saline was administered subcutaneously. The mice were placed on a thermostatic pad for 2 h to facilitate their body temperature recovery from anaesthesia. Sham controls underwent the same surgical procedures but without ligation or puncture. The rectal temperature of the mice was recorded every 2 h using a rectal thermometer throughout the observation period. Blood pressure in the carotid artery was measured using a catheter attached to a Multichannel Physiological Recorder (BIOPAC, USA) with a pressure sensor before the mice were sacrificed.

Lung vascular leak assessment

Lung microvascular leakage was assessed by measuring the extravasated Evans blue (EB) dye, as described previously [26]. EB (0.5%, 0.01 mL/g) was injected into the mice via the tail vein 30 min before sacrificing them. Subsequently, the lungs were perfused with 100 mL of phosphate-buffered saline (PBS) through the right ventricle to remove the intravascular dye. Perfusion was continued until the fluid from the left atrium became colourless. The upper lobes of the left lung were collected, air-dried, and weighed. These samples were then incubated with 500 µL of formamide at 55 °C for 48 h to extract EB from the lung tissues. After centrifugation at 2000 g for 10 min, the absorbance of the supernatants was quantitated spectrophotometrically at 610 nm. A blank containing an equal volume of formamide was used for reference. The concentration of extravasated EB in the lung was calculated using a linear standard curve.

Histopathology and lung injury score

The upper lobes of the left lung were collected 12 h after CLP or sham surgery. The collected lung tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and cut into 4-µm thick sections. These sections were then stained using a haematoxylin-eosin staining kit as per the manufacturer’s instructions. The extent of histological lung injury was quantified using a scoring system [27]. In this system, each of the five independent variables was assigned a weight based on its relevance, as determined by the Committee. The sum of these weighted variables was used to generate a lung injury score, which was then normalised to the number of fields evaluated. The resulting injury score was multiplied by 10 to obtain a continuous value ranging from zero and 10 (inclusive).

Quantitative reverse transcription PCR (RT-PCR)

Total ribonucleic acid (RNA) was extracted from lung tissue using the TRIzol total RNA extraction kit (Solarbio Biotechnology, China) according to the manufacturer’s protocol. Subsequently, complementary DNA (cDNA) was synthesised using the cDNA reverse kit (Cat #RT001, ESscience Biotech, China) as per the manufacturer’s instructions. RT-PCR was performed on a CFX96™ Real-Time system (Bio-Rad Laboratories, Inc., USA) using 2× Universal SYBR Green Fast qPCR Mix (Cat #RK21203, Abclonal, China). The gene expression levels were normalised to β-actin using the delta-delta Ct (2ΔΔCT) relative quantification method. The PCR primer sequences used for measuring gene expression are presented below (F, R): β-actin mouse (TGGAATCCTGTGGCATCCATGAAAC, TAAAACGCAGCTCAGTAACAGTCCG); tumour necrosis factor (TNF)-α mouse (CTTAGACTTTGCGGAGTCCG, ACAGTCCAGGTCACTGTCCC); interleukin (IL)-1β mouse (GACAACTGCACTACAGGCTCC, AGGCCACAGGTATTTTGTCG); monocyte chemoattractant protein (MCP)-1 mouse (CCACTCACCTGCTGCTACTCATTC, CTTCTTTGGGACACCTGCTGCTG).

Immunofluorescence staining

The lung tissue sections were deparaffinised using xylene, followed by dehydration with an ethanol solution. Antigen retrieval was performed by boiling the sections in sodium citrate (pH 6.0) in a microwave oven. Immunofluorescence staining of lung tissue was performed as described previously [19]. The sections were washed with PBS and sealed with 10% goat serum. Subsequently, the sections were incubated overnight at 4℃ with VE-cadherin (Cat #ab33168, Abcam) or occludin (Cat #27260-1-AP, Proteintech Group, China) antibody diluted in PBS. After washing with PBS, the sections were incubated at room temperature for 1 h with fluorescein iso-thiocyanate/cyanine 3-conjugated fluorescent secondary antibodies and stained with 4′,6-diamidino-2-phenylindole. The Images were visualised under a fluorescence microscope (Leica Camera, Germany) and quantified using ImageJ software.

Cell culture and treatment

Primary human umbilical vein endothelial cells (HUVECs) were cultured in endothelial cell medium (Cat#1001, Sciencell, CA, USA) and incubated in a 5% carbon dioxide humidified incubator. HUVECs were seeded in six-well plates and allowed to reach 90% confluence. Subsequently, the cells were treated with 2.0 µg/mL of human recombinant S100A8/A9 (Cat #HY-P71076, MedChemexpress, US) or PBS for 2 h, as reported previously [28].

Western blotting

The right lung lobes weighing 20 mg from each group of mice were lysed with radioimmunoprecipitation assay lysis buffer supplemented with 1% protease and phosphatase inhibitors (Beyotime Biotechnology, China). After centrifugation at 12,000 rpm for 15 min at 4 °C, the protein supernatant was quantified, diluted with 5× loading buffer, and heated at 100 °C for 10 min. A total of 40 µg of protein per sample were separated using sodium dodecyl-sulphate polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes. Subsequently, the membranes were blocked with 5% skim milk for 1.5 h at room temperature and then incubated with the primary antibodies overnight at 4℃. After washing with Tris-buffered saline with 0.1% Tween® 20 detergent to remove the unbound antibodies, the membranes were incubated with corresponding secondary antibodies for 1.5 h at room temperature. Finally, the protein bands were visualised using an electrochemiluminescence imaging system (Bio-Rad Laboratories, Inc., USA). The intensities of protein bands were quantified using ImageJ software. The primary antibodies used in Western blotting included: β-actin (Cat # GB15001, Servicebio Biotechnology, China), S100A8/A9 (Cat #ab33168, Abcam), occludin (Cat #27260-1-AP, Proteintech Group, China), signal transducer and activator of transcription 3 (STAT3) (Cat # 12640S, CST), phosphorylated (p)-STAT3 (Cat #9145S, CST), p38 (Cat #14064-1-AP, Proteintech Group, China), p-p38 (Cat # AF4001, Affinity), ERK (Cat #9102S, CST), p-ERK (Cat #9101S, CST), B-cell leukaemia/lymphoma 2 protein (Bcl-2)-associated X protein (Bax) (Cat # 50599-2-Ig, Proteintech Group, China), Bcl-2 (Cat #BF9103, Affinity).

Bioinformatics analysis

Two datasets, namely GDS4273, were obtained from the Gene Expression Omnibus database (http://www.ncbi.nlm.nih.gov/geo/) to evaluate the diagnostic value of S100A9 in patients with sepsis. The diagnostic value of S100A9 was analysed using the “pROC” R package and visualised using the “sggplot2” R package.

Statistical analysis

All experimental data are presented as the mean ± standard error of the mean. Statistical analysis and generation of graphs were performed using GraphPad Prism 9.0 software. After the normality test and homogeneity test of variances, the Student’s t-test was used to analyse differences between two groups. For comparisons among four groups, two-way analysis of variance and Tukey’s test were employed. Survival differences were assessed using the Kaplan–Meier survival curve and analysed using the log-rank test. Statistical significance was set at P < 0.05.