Exosomes isolation

Centrifuge the supernatant at 300×g 4 °C for 10 min, then harvest the supernatant and centrifuge it at 2000 ×g for 10 min, suck the supernatant and centrifuge at 10,000 ×g for 30 min, harvest the supernatant and 140,000×g overspeed centrifugation for 90 min, remove the supernatant, the sediment is exosomes. Wash the sediment with PBS buffer and centrifuge at 140,000 ×g for 90 min, then resuspend the precipitate with 100 μl PBS buffer and stored the samples at − 80 °C until use.

Patient samples

108 serum samples in total from HER-2+ breast cancer patients who received trastuzumab treatment were collected at Union Hospital, Tongji Medical College, Huazhong University of Science and Technology between June 2015 and June 2018. Samples of 5 ml venous blood from each participant were collected by venipuncture prior to starting trastuzumab treatment. Centrifuge the blood at 1600 × g for 10 min at room temperature within 2 h after collection, then second centrifuge the blood at 12,000 × g for 10 min at 4 °C to remove the residual cells debris. The serum supernatant was transferred into RNase free tubes and stored at -80 °C. All patients were pathologically confirmed, patients with breast benign disease, autoimmune diseases or other types of cancer were excluded.

We evaluated the efficacy of trastuzumab after 2 cycles of treatment. Tumor response was confirmed through computed tomography and evaluated according to the Response Evaluation Criteria In Solid Tumors (RECIST; version 1.1), complete response (CR), partial response (PR), stable disease (SD) and progressive disease (PD). We defined the patients who evaluated with PD were trastuzumab resistant patients, while patients with PR or CR were trastuzumab sensitive patients.

Expression profile analysis of lncRNAs

The quality control for each sample sequence was carried out by FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/), the RNA-seq data were compared by using HISAT2 software, and the expression values from experimental group and control group were statistically calculated by DESeq2.0 algorithm. The calculation parameters mainly included: log2FC value, FDR value, P value. The screening criteria for significant difference factors were log2FC > 1 or < − 1, and FDR < 0.05. According to the results of significant difference genes, the cluster diagram was drawn.

Breast cancer cell lines and cell culture

The human breast cancer cell lines, BT474 and SKBR-3 were acquired from American Type Culture Collection (ATCC) and maintained in McCoy’s 5A with 10% fetal bovine serum and 1% penicillin/streptomycin. The trastuzumab resistant cell lines (BT474-TR and SKBR-3-TR) were established and also maintained in McCoy’s 5A with 10% fetal bovine serum and 1% penicillin/streptomycin. All above cells were cultured at 37 °C with 5% CO2 condition.

Establishment of trastuzumab resistant breast cancer cell lines

Human breast cancer cell lines, SKBR-3 and BT474 cells were treated with trastuzumab (Roche) when the cells grew to 85 ~ 95% density. The initial concentration of trastuzumab is 10 μg/ml, after 24 h induction culture, the cell culture medium was changed to the regular medium without trastuzumab. When the cells grew to 85 ~ 95% density, the cells were stably subcultured for three times at this concentration. Then the breast cancer cells were treated with 20 μg/ml trastuzumab to conduct induction culture for 24 h similar with above steps, untill the cells could stably grow and pass on in the medium at this concentration. Further, the concentration of trastuzumab for induction culture was increased to 40 μg/ml, 60 μg/ml, 80 μg/ml and 100 μg/ml. In this way, we finally obtained trastuzumab resistant breast cancer cells (SKBR-3-TR and BT474-TR) that could stably grow, pass on, cryopreserved and recovered in the culture medium with an effective trastuzumab concentration at 100 μg/ml.

CCK8 assay

Cell viability was analysed by Cell Counting Kit-8 (CCK8, Beyotime, Shanghai, China) following to the manufacturer's protocols. The human breast cancer cells were seeded and cultured into 96-wells plates. Then, the cells were treated with trastuzumab. Add 10 μL of CCK-8 reagent to each well and culture the samples for 2 h. At last the absorbance was analysed at 450 nm by microplate reader. The wells without cells were treated as blanks.

Colony forming assays

The breast cancer cells with log phase growth were plated in 6-well plates. The cells were incubated at 37 °C overnight and treated with trastuzumab. Then the cells were fixed with a mixture of methanol and acetic acid (10:1 v/v) and stained with 1% crystal violet in methanol after 10–14 days of incubation in 6-well plates. At last the numbers of colonies with > 50 cells were counted and the surviving fractions were calculated.

EdU (5-Ethynyl-2-Deoxyuridine) assay

The breast cancer cells were seeded into 96-well plates. The cells were incubated at 37 °C overnight and treated with trastuzumab. Then the cells were incubated with EdU solution for 2 h (1/1000, RiboBio, China). Remove EdU solution and fix the cells with 4% paraformaldehyde for 30 min, permeabilize the cells by 0.5% Triton X-100 for 10 min and stain the cells by Hoechst. At last the EdU positive cells were detected by fluorescent microscope and counted by ImageJ Software.

Transmission electron microscopy

Centrifuge the breast cancer cells at 1000 rpm, 4 °C for 15 min and collect the cancer cells. Incubate the cells with 2.5% glutaraldehyde solution at 4 °C overnight. Then the cells undergo dehydrating, embedding, solidifying, ultrathin slicing, and staining. At last cell samples were observed and imaged by a transmission electron microscope.

Quantitative real-time PCR

The RNA extraction was harvested by using TRIzol reagent (Invitrogen). Then the RNA extraction was undergoing reverse transcription by using Prime RT reagent kit (Vazyme). PCR primer sequences (5'to3') are recorded as follows: human Gapdh-F primer sequence CCACATCGCTCAGACACCAT; human Gapdh-R primer sequence TGACAAGCTTCCCGTTCTCA; human Linc00969-F primer sequence ACGGATCACCACTGCAAGAG; human Linc00969-R primer sequence TAGGTGGAATCGGGCCTGTA; human HUR-F primer sequence GAAGACCACATGGCCGAAGA; human HUR-R primer sequence TGGTCACAAAGCCAAACCCT. Quantitative PCR was performed by using SYBR Green real-time PCR kit (Vazyme).

Western blotting

The whole cell lysates were harvested via cell lysis buffer and the protein concentration was detected with BCA Protein Assay Kit (Thermo). Then the proteins were undergoing separating by 8–12% gradient gels and transferred to PVDF (Polyvinylidene Fluoride) membranes. Membranes were blocked by blocking buffer and incubated with primary antibodies at 4 °C overnight. At last the membranes were incubated with secondary antibodies at room temperature for 1 h and scanned by infrared imaging system. The following primary antibodies were used: TSG101 (1:1000, ab133586, Abcam), CD81 (1:1000, ab109210, Abcam), HUR (1:1000, ab200342, Abcam), HER-2 (1:1000, ab134182, Abcam), GAPDH (1:1000, 60,004–1-Ig, Proteintech), p62 (1:1000, cat. no. 18420–1-AP), LC3 (1:1000, cat. no. 14600–1-AP), CD63 (1:1000, BD Bioscience, clone H5C6), CD9 (1:1000, Millipore, clone MM2/57), Fibronection (1:1200, ab285285, Abcam).

Immunofluorescence staining

The breast cancer cells were fixed by 4% formaldehyde and underwent permeabilizing by PBS with 0.2% Triton X-100. Then the cells were blocked by blocking buffer and incubated with primary antibody at 4 °C overnight. Finally the cell samples were incubated with secondary antibody for 1 h, washed by PBS, mounted in DAPI (4',6-diamidino-2-phenylindole), and observed under confocal laser scanning fluorescence microscopy.

RNA interference and overexpression

BT474 and SKBR-3 cells were transfected with Linc00969 overexpression plasmids. BT474-TR and SKBR-3-TR cells were transfected with siRNA-Linc00969. The transfection kit used was riboFECT™ CP kit as directed by manufacturer’s protocols and the breast cancer cells were used in following experiments after 24 h’ transfection. Overexpression or knockdown cells were confirmed by RT-PCR. (siRNA-Linc00969-1: CGAUUCCACCUACAGCAAAGC; siRNA-Linc00969-2: GGACGGAUCACCACUGCAAGA; siRNA-HUR: TCCAGATTTTTGAAAAATACAAT).

Fluorescence probe in situ hybridization (FISH) assay

Breast cancer cells were fixed by 4% formaldehyde for 20 min, and washed by PBS on a shaker for 5 min × 3 times. Then cells were added protease K (20 μg/ml) to digest for 3 min, and washed by PBS for 5 min × 3 times. Droped the pre-hybridization solution and incubate for 1 h at 37 °C, removed pre-hybridization solution and incubated with probe hybridization solution at 37 °C overnight. Washed the cells by 2 × SSC for 10 min, 1 × SSC for 5 min twice and 0.5 × SSC at 37 °C for 10 min. Finally, cells were mounted in DAPI and observed under fluorescence microscopy.

In vivo xenograft mouse model

Animal experiments were authorized by Medical Ethics Committee of Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, under national standard guidelines for animal welfare. Nude mice (4 weeks old, 16-18 g, BALB/c Nude) were randomly grouped and five nude mice each group. A suspension of 1–5 × 107 human breast cancer cells in 1 ml PBS was perpared, then the medium was mixed with matrigel at the ratio 1:1 for injection. 1–5 × 106 (100 μl) human breast cancer cells were injected subcutaneously into middle posterior part of axilla of each nude mouse and the mice were treated with trastuzumab. Tumor volume was monitered twice a week and calculated by the formula: V = 1/2 × a × b2, where a = length (mm), and b = width (mm).

Immunohistochemistry staining

The subcutaneous trasnplanted tumores were submitted in cassettes for paraffin embedding and sectioning. The tumor Sects. (4 µm) were incubated with primary antibodies at 4 °C overnight, then underwent incubating with secondary antibody and Streptavidin-Avidin–Biotin. Finally, peroxidase reaction was performed by diaminobenzidine tetrahydrochloride and the sections were counterstained by haematoxylin. The sections were visualized under microscope in five independent high magnification fields.

Nucleo-cytoplasmic separation

The nuclear and cytosolic samples of breast cancer cells were separated by utilizing PARIS kit (Am1921, Thermo Fisher Scientific, USA) according to the manufacturer’s protocols. The U1, GAPDH and Linc00969 expression levels in nuclear and cytoplasm of breast cancer cells were detected by qRT-PCR.

RNA pull-down assay

Firstly, the control RNA, target RNA and the probe labeling reaction system were prepared by using Pierce™ RNA 3' End Desthiobiotinylation Kit according to the instructions. The probe labeling reaction system was added into PCR instrument at 16 °C for more than 4 h or overnight, 400 μl nuclease free-water was added into each sample afer reaction. Then 300 μl phenol chloroform was added into samples to extract successfully labeled RNA, centrifuge the samples at fastest speed for 15 min after vibrate, transfer the supernatant to a new EP tube. Secondly, 10 μl 5 M NaCl, 2 μl glycogen and 600 μl pre-colded 100% ethanol were added into the supernatant, then the samples were deposited overnight at -20 °C or -80 °C and centrifuged at fastest speed for 30 min at 4 °C, the precipitate was the RNA sample. Remove the supernatant, wash the RNA by 70% ethanol, centrifuge the samples for 10 min, remove the supernatant again and dry the RNA in air. Finally, 20 μl nuclease free water was added into each sample to dissolve the RNA, then the RNA was added into RNA instrument and denatured for 5 min at 95 °C for following experiments.

The magnetic beads were also need to prepared. Put 400 μl magnetic beads (400 μl for control RNA, 400 μl for target RNA) on the magnetic frame, remove the supernatant, wash the beads by 800 μl 1 × binding & washing buffer 3 times. Then, 400 μl 2 × binding & washing buffer, 20 μl RNA and 380 μl DEPC water were added into the magnetic beads, rotate the samples slowly at room temperature for 20 min, so that the beads could fully bind with RNA. Transfer the samples on the magnetic frame and remove the supernatant, wash the samples by 800 μl 1 × binding & washing buffer 3 times. Finally, the RNA binded beads were washed by cell lysis buffer A for following experiments.

The protein extraction samples were harvested by cell lysis buffer and mixed with the prepared beads (1 U/μl RNase inhibitor was also added), rotate the samples slowly at 4 °C for 2 h, so that the beads could fully combine with protein. Transfer the samples on the magnetic frame, remove the supernatant and wash the samples by 400 μl cell lysis buffer A 5 times. Then, the beads were suspended by 25 μl pre-colded 0.1% SDS solution, added 6.25 μl 5 × protein loading buffer, boiled at 100 °C for 10 min and placed on ice immediately for 5 min. At last the beads were placed on magnetic frame, the supernatant was transfered into a new EP tube for western blotting detection.

RIP (RNA Binding Protein Immunoprecipitation) assay

Firstly, we should prepare the magnetic beads and antibody. The magnetic beads coated with protein-A/G were fully suspended and washed by NT-2 buffer twice, then the magnetic beads were suspended by 100 μl NT-2 buffer and mixed with 5 μg target antibody in room temperature for 1 h. Centrifuge the magnetic beads at 5000 × g for 15 s, add magnetic base to absorb magnetic beads and remove the supernatant, then use 1 ml NT-2 buffer to wash the magnetic beads 5 times. At last the magnetic beads were suspended by 900 μl NET-2 buffer for following experiments.

The cell lysates were harvested via cell lysis buffer and centrifuged at 4 °C 20000 × g for 10 min. Mix 100 μl cell lysate supernatant with 900 μl NET-2 buffer suspended magnetic beads to carry out antibody incubation. Reserve 10 μl sample for “Input” copy and store it at -80 °C. Mix the other sample by vertical mixer at 4 °C for more than 3 h or overnight. Centrifuge the sample for a short time, and put the sample on the magnetic base upon the ice, remove the supernatant after 1 min at 4 °C, then use 1 ml NT-2 buffer to wash the sample 5 times, the precipitate was the final sample got from RIP assay. The RNA sample could be further extracted after digestion by proteinase K for subsequent analysis.

Statistics

The values of samples were represented as mean ± SD which measured triply. Comparisons between two groups were analyzed by unpaired Student’s t test or analyzed by ANOVA for experiments that more than 2 subgroups. P value was considered statistically significant when it < 0.05. The software Graphpad Prism was utilized for statistical analysis.