Flaxseed Supplementation Confers Resilience to Stress-Induced Depression-Like Behaviors via GDNF Epigenetic Modulation in the Ventral Tegmental Area of Rats

Introduction

Depression is a common and serious mental illness affecting approximately 4.4% of the global population and becomes a leading cause of disability globally.1 Despite various pharmacological and psychological treatments, many patients is not satisfactory or no response to conventional therapies, while adverse effects from antidepressants frequently decrease compliance.2,3 These limitations highlight the need for safer or lifestyle-based interventions that support mental health.

Chronic stress is a major risk factor for depression. However, many can adapt and recover from adverse stressful experiences, demonstrating stress resilience – a protective process that reduces vulnerability to stress-related disorders.4,5 Interventions such as exercise and dietary supplementation have shown potential to promote stress resilience and mitigate depression-like behaviors in both preclinical and clinical studies.6

Flaxseed (Linum usitatissimum L)., an excellent source of the dietary essential omega-3 (ω-3/n-3) polyunsaturated fatty acids (PUFAs) in the form of α-linolenic acid (ALA), lignans, and fiber, has gained attention for its potential neuroprotective and mood regulation.7 Studies found that flaxseed supplementation alleviates stress-induced depressive behaviors in rodents.8–10 Moreover, maternal intake of flaxseed in animals can promote resilience and prevent their offspring from developing depressive symptoms, brain damage, and spatial memory loss during experimental neonatal hypoxic-ischemic encephalopathy.11 Recent study further supported the beneficial effects of dietary flaxseed on affective and cognitive performance and reduced oxidative pathways in fructose-fed Wistar rats.12 These findings suggest that flaxseed plays a key regulator of stress resilience and depression. However, the molecular mechanisms remain poorly understood.

Glial cell line-derived neurotrophic factor (GDNF), abundant in the ventral tegmental area (VTA), has been widely accepted as a neurotrophic factor involved in the survival and development of dopaminergic neurons and stress adaptation13, Preclinical study found flaxseed oil supplementation had neuroprotective effects on neurons by increasing GDNF.14 While an increased GDNF level was observed in the VTA of mice that were resilience to social defeat stress,15 and epigenetic modifications of GDNF, such as DNA methylation, have been linked to stress susceptibility and stress resilience.16,17 Nutritional factors, including omega-3 fatty acids, can modulate DNA methylation patterns and gene expression.18 Given the high omega-3 fatty acids content of flaxseed, it is plausible that flaxseed supplementation may exert its antidepressant effects and promote stress resilience by altering GDNF methylation in the VTA.

Therefore, in the current study, rats were subjected to CUS while concurrently given daily diet with flaxseed oil/flour. Then, sucrose preference test and forced swim test were conducted to measure the behavioral performance. Meanwhile, the VTA of rats was collected after behavioral test to detected the methylation and expression of GDNF gene. This study aimed to: (1) determine whether flaxseed oil or flaxseed flour supplementation confer resilience to chronic stress-induced depression-like behaviors; (2) examine whether flaxseed supplementation alters GDNF promoter methylation in the VTA; and (3) evaluate corresponding changes in GDNF mRNA and protein expression in the VTA to elucidate a potential epigenetic mechanism underlying flaxseed-induced stress resilience.

Materials and Methods Animal and Design

Sprague dawley (SD) rats (male, 150g–200g) were used in this study and purchased from Hunan SJA Laboratory Animal Co., Ltd. Forty-eight animals were randomly allocated to six groups: blank control (BC, N=8), chronic unpredictable stress alone (CUS, N=8), flaxseeds oil alone (FO, N=8), flaxseed flour alone (FF, N=8), CUS treated with flaxseeds oil (CUS/FO, N=8), and CUS treated with flaxseed flour (CUS/FF, N=8). FO, FF, CUS/FO, CUS/FF rats treated flaxseeds oil or flour for 5 weeks. During the second week of the 5-week period, CUS, CUS/FO, CUS/FL rats were subjected to chronic unpredictable stress for 4 weeks. BC rats did not receive any experimental manipulation. The study design is shown in Figure 1. All animals were housed on a 12-hour light/dark cycle with free access to water and food.

Figure 1 Experiment schedule.

Abbreviations: 1w, the first week; 2w, the second week; 3w, the third week; 4w, the fourth week; 5w, the fifth week; CUS, chronic unpredictable stress.

Chronic Unpredictable Stress (CUS)

The CUS paradigm was performed according to a published protocol.19 Briefly, after a week of acclimatization, rats were sequentially exposed to stressors for a total of 4 weeks, containing crowding for 2 hours, an elevated open platform for 2 hours, restraint stress for 2 hours, wet bedding for 15 hours, feed and water deprivation for 24 hours. Each stressor was given 3–4 times. To avoid the rats predicting the occurrence of the next stressor, the same stressor was not given for 2 consecutive days.

Flaxseed Intervention

According to a published protocol,9 rats in the FO and CUS/FO group were fed with 10% flaxseed oil supplementation in their feed, and rats in the FF and CUS/FF group were fed with 20% flaxseed flour supplementation in their feed. All rats can freely take their feed. All interventions were conducted for 5 weeks (1 week of pretreatment and 4 weeks of flaxseed plus CUS). Flaxseed oil was extracted from flaxseed by cold-processed, and flaxseed flour was the main byproduct from the flaxseed oil extraction. Flaxseed contained 49.90% of α-linolenic acid and 5.24% of SDG.

Body Weight Measure

To assess the effect of flaxseed on the bodyweight, the body weight of each rats measured the day prior to the pre-treatment flaxseed (baseline weight), then once a week during experimental animal treatments. The percent change in bodyweight from baseline weight is reported.

Behavioral Test

Sucrose Preference Test (SPT): SPT measures the anhedonia level in rodents.19 The entire test was conducted for 72 hours in total. In the first 24 hours, rats were housed in a single cage with two water bottles containing 1.5% sucrose. In the second 24 hours, one bottle of sucrose water was replaced with plain water. In the last 24 hours, the rats were deprived of water and feed for 18 hours, and then they were given one bottle of pre-weighed 1.5% sucrose solution and one bottle of pre-weighed plain water. One hour later, the consumption of sucrose and plain water was weighted. The sucrose preference rate = [sucrose consumption/(plain water consumption + sucrose consumption)] *100%.

Forced Swimming Test (FST): FST assesses despair behavior and coping strategies under acute stress in rodents.19 The testing process contains two forced swimming sessions: one is a 15-min pretest on the 1st day and one is a 5-min test on the next day. Rats were forced to swim in a glass cylinder (30 cm diameter × 40 cm high) containing 30 cm depth of water (25 ± 1 °C). The immobility time, climbing time, and swimming time were record. A longer immobility time, shorter climbing and swimming time mean higher despair level and more passive coping strategies in rats. The swimming bucket was cleaned after each test.

Both SPT and FST were tested at the beginning (baseline) and after 5-week of the experimental animal treatments (T1).

The Ventral Tegmental Area (VTA) Tissue Dissection and Collection

When all behavioral tests were completed after 5-week of the experimental animal treatments, rats were decapitated and craniotomies were performed. Brain was rapidly removed, and the whole VTA tissue was dissected on ice with coronal section rodent brain matrices (1 mm) according to the rat brain in stereotaxic coordinates. Especially, the VTA tissue was taken at AP −5.0 to −6.8 mm.20 Samples were frozen in liquid nitrogen and then stored at −80 °C.

Real-Time Quantitative Reverse Transcription PCR (qRT-PCR)

qRT-PCR was used to measure GDNF mRNA levels in the VTA. The total RNA was isolated using Trizol (Life Technologies) reagent. qRT-PCR of GDNF gene was performed using a pair of primers: TTCAAGCCACCATCAAAAGAC (Forward) and GTAGCCCAAACCCAAGTCAGT (Reverse), while β-actin was amplified using CACCCGCGAGTACAACCTTC (Forward) and CCCATACCCACCATCACACC (Reverse) as an internal control. Data were analyzed using the comparative ΔΔCt method.

Protein Extraction and Western Blot

The protein level of GDNF in the VTA tissue homogenates was measured using Western blot as previously described.21 Anti-GDNF antibody and anti- β-actin antibody were purchased from Abcam (Cambridge, MA, USA). Expression of total GDNF levels was evaluated relative to β-actin (ie, relative density=GDNF/β-actin levels). Background correction values were subtracted from each lane to minimize the variability across membranes.

DNA Isolation and DNA Methylation Analysis

Genomic DNA was isolated from the VTA tissue using proteinase K/phenolchloroform extraction method. The DNA was dissolved in TE buffer, and the DNA concentration was measured. CpG islands of GNDF gene promoter were selected as previously described.17 CpG islands were finally sequenced using BiSulfite Amplicon sequencing PCR. The methylation level at each CpG site was calculated and then averaged.

Statistical Analysis

Data were analyzed using SPSS23.0 statistical software and expressed as mean±SEM. Bodyweight and behavioral data were analyzed by repeated one-way ANOVA. One-way ANOVA was used to analyze the bio-indexes. Post hocs test was adjusted for multiple comparisons by LSD. p<0.05 was used as the statistical significance.

Results Body Weight

On baseline, there was not significantly different in the body weight of rat across six group (F=1.119, p=0.365) (Figure 2a). During 5-weeks intervention, one-way repeated ANOVA showed that in the change of bodyweight, the main effects of time (F=35.640, p<0.001) were significant. There was no significant main effect of group (F=1.435, p=0.232) and interaction effect of time × group (F=0.200, p>0.05) (Figure 2b).

Figure 2 Behavioral tests in rats. (a) the body weight at baseline; (b) the change of body weight during 5 weeks (%); (c) sucrose preference rate in sucrose preference test; (d) Immobility time, (e) climbing time, and (f) swimming time in forced swimming test. Data were expressed as mean ± SEM. *compared with BC group, #compared with CUS group.

Abbreviations: BC, blank control; FO, flaxseed oil alone; FF, flaxseed flour alone; CUS/FO, chronic unpredictable stress (CUS) plus flaxseed oil; CUS/FF, CUS plus flaxseed flour; CUS, CUS alone. Baseline, the beginning of the experimental procedure; T1, the end of 5-week procedure.

Behavioral Measurements

In SPT, one-way repeated ANOVA showed that in sucrose preference rates, the main effects of time (F=22.322, p<0.001), group (F=8.325, p<0.001), and interaction effect of time × group (F=10.271, p<0.001) were all significant. Specifically, Post hocs analysis revealed that there was no significant difference of the sucrose preference rate at baseline among six groups (p values > 0.05). At T1, rats in the CUS/FF and CUS group had significantly lower sucrose preference rates, but higher in FO, compared with BC group (p values <0.01); there were significantly higher sucrose preference rates of rats in CUS/FO, FO, and FF group than that in CUS (p values <0.01), but no significant difference was observed between CUS/FO and BC rats (p>0.05) (Figure 2c).

In FST, one-way repeated ANOVA showed that in immobility time, the main effects of time points (F=89.988, p<0.001), group (F=8.589, p<0.001), and interaction effect of time points × group (F=14.258, p<0.001) were all significant. Specifically, post hoc analysis revealed that there was no significant difference of the immobility time at baseline among all six groups (p values >0.05). At T1, rats in the CUS group had significant longer immobility time compared with other five groups (p values <0.01), among which there were no significant differences (p values >0.05) (Figure 2d).

One-way repeated ANOVA showed that in climbing time, the main effect of group (F=2.445, p=0.049) were significant, but not the main effect of time points (F=0.730, p=0.398) and interaction effect of time points × group (F=2.442, p=0.050). Specifically, post hoc analysis revealed that there was no significant difference of the climbing time at baseline among all six groups (p values >0.05). At T1, rats in the CUS group had significantly shorter climbing time compared with other five groups (p values <0.01), among which there were no significant differences (p values >0.05) (Figure 2e).

One-way repeated ANOVA showed that in swimming time, the main effects of time points (F=0.044, p=0.834), group (F=1.594, p=0.183), and interaction effect of time points × group (F=1.642, p=0.170) were all not significant. There was no significant difference of the swimming time at baseline among all six groups (p values >0.05). At T1, rats in the BC, FO, and FF groups had significantly longer swimming time compared with rats in CUS group (p values <0.01) (Figure 2f).

The Expression of GDNF Gene in the VTA

One-way ANOVA showed that there were significant differences in GDNF protein (F=92.539, p<0.001) and mRNA (F=8.674, p<0.001) expression in the VTA of rats. Specifically, post hoc tests revealed that the expression of GDNF protein in CUS/FO, CUSS/FF, and CUS rats was significantly lower, but higher in FO rats, compared with BC rats (p values <0.01). Rats in CUS/FO, FO and FF had significantly higher GDNF protein than CUS rats (p values <0.01) (Figure 3a). The expression of GDNF mRNA in CUS/FF and CUS rats was significantly lower, but higher in FO rats, compared with BC rats (p values <0.01) (Figure 3b).

Figure 3 The expression and methylation level of GDNF gene in the VTA of rats. (a) GDNF relative protein level; (b) the expression of GDNF mRNA; (c) GDNF gene methylation level. Data were expressed as mean ± SEM. *compared with BC group, #compared with CUS group.

Abbreviations: BC, blank control; FO, flaxseed oil alone; FF, flaxseed flour alone; CUS/FO, chronic unpredictable stress (CUS) plus flaxseed oil; CUS/FF, CUS plus flaxseed flour; CUS, CUS alone.

The Level of DNA Methylation on GDNF Gene Promotor in the VTA

The methylation level of CpG sites was measured within the GDNF gene promoter in the VTA of rats at T1. Results revealed significant group differences in the level of DNA methylation of GDNF gene promotor (F=23.954, p<0.001). Specifically, post hoc tests revealed that the level of DNA methylation in GDNF gene promotor was significantly higher in CUS rats than that in other five groups (p values <0.01), among which there were no significant differences (p values >0.05) (Figure 3c).

Discussion

A large body of studies revealed that the CUS-induced rodent model successfully mimics key clinical features of depression and has been widely used to study pathophysiology and treatments effects.22,23 In the present study, 4-weeks of CUS significantly decreased the sucrose preference rate in the SPT, and prolonged immobility time, decreased climbing and swimming time in the FST. These behavioral changes are considered to reflect anhedonia, behavioral despair, and passive coping strategies, respectively, which parallel core symptoms observed in patients with depressive disorders.24,25 Consistent with previous reports, our findings showed that flaxseed supplementation can alleviate depressive behaviors in animal models of chronic stress.9,10 Specifically, both flaxseed oil and flour supplementation prevent against despair-like and passive behaviors (reversed the prolonged immobility time and decreased climbing). Notably, only flaxseed oil significantly increased the sucrose preference rate in the SPT, suggesting a unique capacity to mitigate anhedonia, a core and often treatment-resistant symptom of depression.26 The findings highlight the possibility that flaxseed oil could serve as a low-cost, well-tolerated dietary adjunct to conventional treatment, particularly for individuals with prominent anhedonia.

One of the key findings of this study is that flaxseed oil supplementation significantly enhanced “liking” reactions to sucrose in the SPT in non-stressed rats, suggesting an improvement in hedonic capacity. Hedonia, or the ability to experience pleasure, is a critical component of stress resilience. Individuals with higher hedonic tone are generally better equipped to cope with environmental stressors, as they are more likely to engage in positive reinforcement behaviors and maintain emotional stability in the face of adversity.27–29 Our results indicate that flaxseed oil may enhance hedonic responsiveness and thereby increase resilience to future stressors. These findings are consistent with previous studies showing that interventions targeting the reward system, including omega-3 fatty acid supplementation, can enhance stress resilience and improve mood.30 Clinically, this could translate into a preventive or early-intervention strategy for at-risk populations (eg, adolescents under academic pressure or individuals with subthreshold depressive symptoms), by supporting reward system function before full-blown depression emerges. Controlled clinical trials are needed to determine whether similar hedonic and resilience-enhancing effects of flaxseed oil occur in humans, and to identify appropriate doses and durations of supplementation.

Neurobiological studies have demonstrated that both stress resilience and depression were closely linked to alterations in the ventral tegmental area (VTA) and its dopaminergic circuits.31 GDNF is a key neurotrophic factor that promotes the survival and function of dopaminergic neurons in the VTA.32 In the present study, CUS significantly decreased the expression of GDNF protein and mRNA in the VTA, whereas flaxseed oil but not flaxseed flour normalized the GDNF levels in stressed rats and increased GDNF expression even under non-stress conditions. The differential effects of flaxseed oil and flour on anhedonia and GDNF expression may reflect distinct mechanisms of their bioactive components.33 Flaxseed oil is rich in alpha-linolenic acid (ALA), an omega-3 fatty acid that has been shown to modulate dopaminergic signaling and neuroplasticity, both critical for reward processing.34 In contrast, flaxseed flour contains secoisolariciresinol diglucoside (SDG), which may act primarily through antioxidant and anti-inflammatory pathways.35 These data suggest that specific flaxseed-derived components, especially ALA-rich oil, may be more relevant for targeting reward-related deficits and dopaminergic dysfunction in depression. This opens a potential avenue for “precision nutrition” approaches, in which particular formulations or combinations of flaxseed components are tailored to symptom profiles (eg, anhedonia vs inflammation-dominant presentations). Future studies should disentangle the relative contributions and possible synergistic effects of ALA and SDG and explore their impact in clinical populations.

Epigenetic mechanisms can link external psychological stressors and internal biological systems emerging as a molecular correlate of stress response. DNA methylation (DNAm) is considered the most stable epigenetic alteration. In this study, CUS significantly increases DNA methylation in the promotor of the GDNF gene in the VTA of rats, while both flaxseed oil and flaxseed flour supplementation reversed this hypermethylation. To our knowledge, this is the first report that flaxseed can regulate the methylation level of GDNF gene in stressed model. Previous study demonstrated that specific epigenetic modifications were linked to stress susceptibility vs resilience. Specifically, resilient mice showed decreased DNA methylation in the promotor of GNDF, allowing transcription of the gene. In contrast, in stress-susceptible mice, increasing DNA methylation and inhibiting GDNF transcription was detected. Moreover, pharmacological or genetic manipulations recovered the methylation of GDNF leading to a susceptible phenotype in resilience animals.15 Together with these findings, our results support the notion that targeting GDNF-related epigenetic regulation may be a promising strategy to promote stress resilience and antidepression.

It is undeniable that this study also has several limitations. Firstly, although the contents of α-linolenic acid and SDG in flaxseed were measured, the compositions of flaxseed oil and flour extracted from the flaxseed were not measured anymore. In addition, flaxseed oil or flour mixed into feed, which makes it difficult to accurately determine the amount of oil, flour and its contents consumed by the rats. In the future, the chemical characteristics and effects of flaxseed may need to be studied with a strict design and an accurate dosage. Secondly, although SPT and FST both are widely use to prove the behavior changes after CUS and treatments, more behavioral tests also need to verify the effects of flaxseed from multiple perspectives. In addition, our study only investigated GDNF gene methylation in the VTA. The alterations in other specific brain areas associated with depression and stress resilience should be explored (eg, hippocampus, prefrontal cortex, nucleus accumbens). Thirdly, only male rats were used. The absence of females limits the generalizability of the findings, particularly in light of the hormonal sensitivity of GDNF and well-documented sex differences in stress responsivity and depression-like behaviors. Future studies should include both sexes and consider estrous-cycle–related effects to more accurately reflect the diversity of stress responses.

Conclusions

In conclusion, our study demonstrates that flaxseed supplementation, particularly flaxseed oil, can confer stress resilience and attenuate depression-like behaviors in rats. In addition, enhancing hedonic capacity may be a key mechanism by which flaxseed promotes resilience to stress. These behavioral improvements may be mediated, at least in part, by a decrease in GDNF gene promoter methylation and, subsequently, the up-regulation of GDNF gene expression in the VTA. Although the current results are derived from a rodent model and cannot be directly extrapolated to patients, they provide a mechanistic rationale for future clinical research on flaxseed-based nutritional interventions as adjuncts to standard depression treatments, with a specific focus on anhedonia and stress resilience.

Ethics Statement

This study complied with the Chinese Guidelines for Ethical Review of Laboratory Animals (GB/T 35892-2018) and was approved by the Institutional Animal Care and Use Committee (lACUC), The Second Xiangya Hospital, Central South University (approval no. 20240975).

Author Contributions

Qing Lu, Xinyu Chen: performing experiments, data analysis, and preparing manuscript. Xiao Zhou and Ruoyi Zhang and Xin Deng: performing experiments and data collection; Yi Zhang, Xiongzhao Zhu: study design, manuscript revision, and final approval. All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.

Funding

This study was supported by Hunan Provincial Natural Science Foundation China (no. 2025JJ70428), Hunan Province Traditional Chinese Medicine Research Program under grant (no. E2022038), National Natural Science Foundation of China under grant (No. 81701333).

Disclosure

The authors report no conflicts of interest in this work.

References

1. World Health Organization. Depression and other common mental disorders: global health estimates (Internet). 2018. Geneva, Switzerland: World Health Organization. Available from: http://apps.who.int/iris/bitstream/10665/254610/1/WHO-MSD-MER-2017.2-eng.pdf?ua=1. Accessed 1, September 2018.

2. Cipriani A, Furukawa TA, Salanti G, et al. Comparative efficacy and acceptability of 21 antidepressant drugs for the acute treatment of adults with major depressive disorder: a systematic review and network meta-analysis. Lancet. 2018;391(10128):1357–1366. doi:10.1016/S0140-6736(17)32802-7

3. Kishi T, Ikuta T, Sakuma K, et al. Antidepressants for the treatment of adults with major depressive disorder in the maintenance phase: a systematic review and network meta-analysis. Mol Psychiatry. 2023;28(1):402–409. doi:10.1038/s41380-022-01824-z

4. Russo SJ, Murrough JW, Han MH, Charney DS, Nestler EJ. Neurobiology of resilience. Nat Neurosci. 2012;17:27–29.

5. Southwick SM, Charney DS. The science of resilience: implications for prevention and treatment of depression. Science. 2012;338:79–82. doi:10.1126/science.1222942

6. Hermans EJ, Hendler T, Kalisch R. Building resilience: the stress response as a driving force for neuroplasticity and adaptation. Biol Psychiatry. 2025;97(4):330–338. doi:10.1016/j.biopsych.2024.10.016

7. Al-Madhagy S, Ashmawy NS, Mamdouh A, Eldahshan OA, Farag MA. A comprehensive review of the health benefits of flaxseed oil in relation to its chemical composition and comparison with other omega-3-rich oils. Eur J Med Res. 2023;28(1):240. doi:10.1186/s40001-023-01203-6

8. Steyn SF, Harvey BH, Brink CB. Immediate and long-term antidepressive-like effects of pre-pubertal escitalopram and omega-3 supplementation combination in young adult stress-sensitive rats. Behav Brain Res. 2018;351:49–62. doi:10.1016/j.bbr.2018.05.021

9. Han Y, Deng X, Zhang Y, et al. Antidepressant-like effect of flaxseed in rats exposed to chronic unpredictable stress. Brain Behav. 2020;10(6):e01626. doi:10.1002/brb3.1626

10. Naveen S, Siddalingaswamy M, Singsit D, Khanum F. Anti-depressive effect of polyphenols and omega-3 fatty acid from pomegranate peel and flax seed in mice exposed to chronic mild stress. Psychiatry Clin Neurosci. 2013;67(7):501–508. doi:10.1111/pcn.12100

11. Mucci Dde B, Fernandes FS, Souza Ados S, Sardinha FL, Soares-Mota M, Tavares Do Carmo M. Flaxseed mitigates brain mass loss, improving motor hyperactivity and spatial memory, in a rodent model of neonatal hypoxic-ischemic encephalopathy. Prostaglandins Leukot Essent Fatty Acids. 2015;97:13–19. doi:10.1016/j.plefa.2015.03.001

12. Elkaoui H, Chakit M, Mesfioui A, Elhessni A. Flaxseed administration improves affective and cognitive functions in fructose diet Wistar rats. Egypt J Vet Sci. 2025;56(13):403–412.

13. Lindholm P, Saarma M. Cerebral dopamine neurotrophic factor protects and repairs dopamine neurons by novel mechanism. Mol Psychiatry. 2022;27(3):1310–1321. doi:10.1038/s41380-021-01394-6

14. Bagheri A, Talei S, Hassanzadeh N, et al. The neuroprotective effects of flaxseed oil supplementation on functional motor recovery in a model of ischemic brain stroke: upregulation of BDNF and GDNF. Acta Med Iran. 2017;55(12):785–792.

15. Krishnan V, Han MH, Graham DL, et al. Molecular adaptations underlying susceptibility and resistance to social defeat in brain reward regions. Cell. 2007;131(2):391–404. doi:10.1016/j.cell.2007.09.018

16. Uchida S, Hara K, Kobayashi A, et al. Epigenetic status of Gdnf in the ventral striatum determines susceptibility and adaptation to daily stressful events. Neuron. 2011;69(2):359–372. doi:10.1016/j.neuron.2010.12.023

17. Zhang Y, Wang L, Wang X, Wang Y, Li C, Zhu X. Alterations of DNA methylation at GDNF gene promoter in the ventral tegmental area of adult depression-like rats induced by maternal deprivation. Front Psychiatry. 2019;9:732. doi:10.3389/fpsyt.2018.00732

18. González-Becerra K, Ramos-Lopez O, Barrón-Cabrera E, et al. Fatty acids, epigenetic mechanisms and chronic diseases: a systematic review. Lipids Health Dis. 2019;18(1):178. doi:10.1186/s12944-019-1120-6

19. Zhang Y, Wang Y, Lei H, et al. Optimized animal model to mimic the reality of stress-induced depression in the clinic. BMC Psychiatry. 2017;17(1):171. doi:10.1186/s12888-017-1335-x

20. Paxinos G, Watson C. The Rat Brain in Stereotaxic Coordinates. 4th ed. Academic Press; 1998.

21. Zhang X, Lee TH, Davidson C, Lazarus C, Wetsel WC, Ellinwood EH. Reversal of cocaine-induced behavioral sensitization and associated phosphorylation of the NR2B and GluR1 subunits of the NMDA and AMPA receptors. Neuropsychopharmacology. 2007;32(2):377–387. doi:10.1038/sj.npp.1301101

22. Antoniuk S, Bijata M, Ponimaskin E, Wlodarczyk J. Chronic unpredictable mild stress for modeling depression in rodents: meta-analysis of model reliability. NeurosciBiobehav Rev. 2019;99:101–116.

23. Sharma S, Chawla S, Kumar P, Ahmad R, Kumar Verma P. The chronic unpredictable mild stress (CUMS) paradigm: bridging the gap in depression research from bench to bedside. Brain Res. 2024;1843:149123. doi:10.1016/j.brainres.2024.149123

24. Primo MJ, Fonseca-Rodrigues D, Almeida A, Teixeira PM, Pinto-Ribeiro F. Sucrose preference test: a systematic review of protocols for the assessment of anhedonia in rodents. Eur Neuropsychopharmacol. 2023;77:80–92. doi:10.1016/j.euroneuro.2023.08.496

25. Brandwein C, Leenaars CHC, Becker L, et al. A systematic mapping review of the evolution of the rat Forced Swim Test: protocols and outcome parameters. Pharmacol Res. 2023;196:106917. PMID: 37690532. doi:10.1016/j.phrs.2023.106917

26. Buckner JD, Joiner TE Jr, Pettit JW, Lewinsohn PM, Schmidt NB. Implications of the DSM’s emphasis on sadness and anhedonia in major depressive disorder. Psychiatry Res. 2008;159(1–2):25–30. doi:10.1016/j.psychres.2007.05.010

27. Southwick SM, Charney DS. Resilience: The Science of Mastering Life’s Greatest Challenges. Cambridge University Press; 2012.

28. Ho CY, Berridge KC. An orexin hotspot in ventral pallidumamplifies hedonic ‘liking’ for sweetness. Neuropsychopharmacology. 2013;9:1655–1664. doi:10.1038/npp.2013.62

29. Ji MJ, Zhang XY, Chen Z, Wang JJ, Zhu JN. Orexin prevents depressive-like behavior by promoting stress resilience. Mol Psychiatry. 2019;24(2):282–293. doi:10.1038/s41380-018-0127-0

30. Logan AC. Omega-3 fatty acids and major depression: a primer for the mental health professional. Lipids Health Dis. 2004;3:25. doi:10.1186/1476-511X-3-25

31. Friedman AK, Walsh JJ, Juarez B, et al. Enhancing depression mechanisms in midbrain dopamine neurons achieves homeostatic resilience. Science. 2014;344(6181):313–319. doi:10.1126/science.1249240

32. Mendez I, Dagher A, Hong M, et al. Enhancement of survival of stored dopaminergic cells and promotion of graft survival by exposure of human fetal nigral tissue to glial cell line--derived neurotrophic factor in patients with Parkinson’s disease. Report of two cases and technical considerations. J Neurosurg. 2000;92(5):863–869. doi:10.3171/jns.2000.92.5.0863

33. Parikh M, Maddaford TG, Austria JA, Aliani M, Netticadan T, Pierce GN. Dietary Flaxseed as a Strategy for Improving Human Health. Nutrients. 2019;11(5):1171. doi:10.3390/nu11051171

34. Chalon S. Omega-3 fatty acids and monoamine neurotransmission. Prostaglandins Leukot Essent Fatty Acids. 2006;75(4–5):259–269. doi:10.1016/j.plefa.2006.07.005

35. Kezimana P, Dmitriev AA, Kudryavtseva AV, Romanova EV, Melnikova NV. Secoisolariciresinol diglucoside of flaxseed and its metabolites: biosynthesis and potential for nutraceuticals. Front Genet. 2018;9:641. doi:10.3389/fgene.2018.00641

Comments (0)

No login
gif